Busch Lab

ZMP

bbs4

Ensembl ID:
ENSDARG00000063522
ZFIN ID:
ZDB-GENE-060126-2
Description:
Bardet-Biedl syndrome 4 [Source:RefSeq peptide;Acc:NP_001070934]
Human Orthologue:
BBS4
Human Description:
Bardet-Biedl syndrome 4 [Source:HGNC Symbol;Acc:969]
Mouse Orthologue:
Bbs4
Mouse Description:
Bardet-Biedl syndrome 4 (human) Gene [Source:MGI Symbol;Acc:MGI:2143311]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa258 Nonsense F2 line generated Not yet available
sa11279 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa258
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092919 Nonsense 160 359 8 16
ENSDART00000122929 Nonsense 160 528 8 16

The following transcripts of ENSDARG00000063522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 2624919)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 2532310
GRCz11 25 2685700
KASP Assay ID:
554-2691.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTGGGTTTCTGTTCTCTCCGTGTCTGCAGGCAGAAGAGCAGTTAAACT[T/A]GGCATTACAGCTGAATAAACACGATCTGACCTACATGATGCTGGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092919 Nonsense 298 359 12 16
ENSDART00000122929 Nonsense 298 528 12 16

The following transcripts of ENSDARG00000063522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 2636410)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 2543801
GRCz11 25 2697191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTATCTTTTGATATTTMAGGCCATCAGCTGTCTGAAGAGAGCGAATTA[T/G]CTGTCTCCKTTTGACTGGAAGATTYTGTATAATCTGGGTTTGGTTCACCT
Associated Phenotype:
Not determined