Busch Lab

ZMP

arfgef1

Ensembl ID:
ENSDARG00000063474
ZFIN ID:
ZDB-GENE-030131-108
Description:
Im:7138204 protein [Source:UniProtKB/TrEMBL;Acc:Q6DEJ1]
Human Orthologue:
ARFGEF1
Human Description:
ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) [Source:HGNC Sym
Mouse Orthologue:
Arfgef1
Mouse Description:
ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) Gene [Source:MGI

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa14568 Nonsense Available for shipment Available now
sa30078 Nonsense Mutation detected in F1 DNA Not yet available
sa37862 Nonsense Mutation detected in F1 DNA Not yet available
sa17540 Essential Splice Site Available for shipment Available now
sa778 Nonsense F2 line generated Not yet available
sa10355 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30079
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 43 1849 2 39
Genomic Location (Zv9):
Chromosome 24 (position 19390225)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18696379
GRCz11 24 18840798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGTCTATTTGCCTCACTCATGTGAATCTTTTCTTTTCTTTTGCAGAG[G/T]AAATCAAGCAGGAATCGGAGAAATTAAGGTAAGTCGATATCTTGTGCTAC
Long Flanking Sequence:
CAAGCTGGGAATCAAACTTGGGTCACTGTGAGCACCATGGTGCTATATGTCAGCGCACTTAACCACTATTGGTGCCGACAACAAACTAAAATTGTTTATATTGCAAGTTGTTTATCAATTATCACTAGCTTTGAAATATAAAATATGGATGACGTCATTAGCATTAATGGAATGCAGATATAACTACAATTAAAATTGCAACACATACACATTATTTATAGCATTTACAAACATTTTAAGATACAGTTCTTTGAAAGCATCCTTTTTCATTGTATTATTATTTCTAACAAAACAAATATTTACTGCATTTTATCTCAAAAGGCTTCAAAGTCTTGTGTTTACCTGCTAGTACACGGTAAACAAGTCAAGACTGCTTTTGTAGCTGCTTTTAATGCAACCTCATTAGCCTTTACGGTCTGCTATAGGCAGTTTATTTATTTAGTATTGTCAGTCAGTCTATTTGCCTCACTCATGTGAATCTTTTCTTTTCTTTTGCAGAG[G/T]AAATCAAGCAGGAATCGGAGAAATTAAGGTAAGTCGATATCTTGTGCTACACCCCAGCAGTTGATATATTGAACTAGTGTTTCAAAAATCCCCCTTCTTTATTGTTGTCGAGTTCACTGCTTGTAATGAAGCCCTGACATTTTCCAGAGAGTATACCACACGCGGCCTCTTTGTGTTTTAGCTGCTGTTCTGGCCTTATTGTGATTTGTGTGTGTATGTGTGTGAGAGAAAAAACACCCCTTGTGGTCTGTGTTGTTAATGTGCTTGGAGACCTTGCTGTGTGGACACAGGAATGAGACATACTGTGCTCAGGGCTTTCTGCAGGGCCAGGGCGGCCTGTTCCGAGGACCTTCATCTCTCACCCTCTACGTCTATTAATTCACAGCTCACCTGTTTCACCACATCGGCCAGCTTTCTCATCCATGACTGTGTCTTTTGGCTTTTCTTTTCTTTATTGCTTGCATGTGTCTGTTTTAAAATCAGGGAGCACTGCTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4277
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 652 1849 14 39
Genomic Location (Zv9):
Chromosome 24 (position 19336539)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18642693
GRCz11 24 18787112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTCTCTAAACCCTCATCTGAATTTCWTTCCCCTCTTTTTCAATCAGGY[C/T]AAGAAAAGCCTTCAGAGCAGGAGAGCAATGAGTCGAAGCATCCAGAAACG
Long Flanking Sequence:
GTCTCTCAGCTTGTTTCTCTAATCTTTCCAAGGGAAGAAACTGTAAGAGATAAAGAAGTGACCCGACAGCTCATGTTACAGTGATAGCTACCCACTAAATCTTTTACAGTGTTTCCAGTGTGCAATTAGATCCTGCAAACTGCAACCATGGCTTCCACATACCCGACCGCCTATTTGTTTTGCTTTGCACCAACTTCAGATCTGTTACTTGGTGTATACAGGTCATGCTGCTCTTACTCCTGTCCCCATCGTGCTGTTTTTTGTGATACGAGTCAGCAGAGACCAAAGACTTTATTAGAGAAGTGTTGTATTGGGAAACTCATATAGGAAGCAGAGCCAGAGAAAAGGCTCAATACACCAACTCACATTTGAGCCAAACAGGATTTTCAATGAATCATGCTGTCTCTACTCTCTAGGCTGTTTCACAAAACAGGCTCCACACTTCTTCTGCTTTCTCTAAACCCTCATCTGAATTTCATTCCCCTCTTTTTCAATCAGGC[C/T]AAGAAAAGCCTTCAGAGCAGGAGAGCAATGAGTCGAAGCATCCAGAAACGATCAACCGTTACGGCAGCATTAACTCTTTGGACTCCACTGCATCATCAGGCATTGGGAGCTACAGCACACAGATGTCCGGAACAGACAACCCGGAGCAGTTTGAGGTCCTCAAACAACAGAAGGAGATCATAGAGCAAGGCATTGACCTGTAAGCCACCAAGTTGAAACCACAAAACATCAAATCAGTCTCTGCATTATACAAGATGTTGATAAAATCTAGTATATATTTGTATTGAAATTGAAAGAGTGTCTAGTGTCTAGTCTAGTGTTGCTCCTTGAGGGCCACTATTAGCCCTTTTCCACCAAAGATGTTCCAGAGTCTAGTTCCAAATCGTTTTTTTGTCTTTTGATCCCCAAAGCAAGTAAGTTAGTAAGTTTAAGTAGCATCAAAACTTGTCTTTTGTGCCTGCATCAGAGTCCAGAGTTACAGTGACCAATGACACTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14568
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 692 1849 14 39
Genomic Location (Zv9):
Chromosome 24 (position 19336419)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18642573
GRCz11 24 18786992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAACTCTTTGGACTCCACTGCATCATCAGGCATTGGGAGCTACAGCACR[C/T]AGATGTCCGGAACAGACAACCCKGAGCAGTTTGAGGTCCTCAAACAACAG
Long Flanking Sequence:
TGCAATTAGATCCTGCAAACTGCAACCATGGCTTCCACATACCCGACCGCCTATTTGTTTTGCTTTGCACCAACTTCAGATCTGTTACTTGGTGTATACAGGTCATGCTGCTCTTACTCCTGTCCCCATCGTGCTGTTTTTTGTGATACGAGTCAGCAGAGACCAAAGACTTTATTAGAGAAGTGTTGTATTGGGAAACTCATATAGGAAGCAGAGCCAGAGAAAAGGCTCAATACACCAACTCACATTTGAGCCAAACAGGATTTTCAATGAATCATGCTGTCTCTACTCTCTAGGCTGTTTCACAAAACAGGCTCCACACTTCTTCTGCTTTCTCTAAACCCTCATCTGAATTTCATTCCCCTCTTTTTCAATCAGGCCAAGAAAAGCCTTCAGAGCAGGAGAGCAATGAGTCGAAGCATCCAGAAACGATCAACCGTTACGGCAGCATTAACTCTTTGGACTCCACTGCATCATCAGGCATTGGGAGCTACAGCACA[C/T]AGATGTCCGGAACAGACAACCCGGAGCAGTTTGAGGTCCTCAAACAACAGAAGGAGATCATAGAGCAAGGCATTGACCTGTAAGCCACCAAGTTGAAACCACAAAACATCAAATCAGTCTCTGCATTATACAAGATGTTGATAAAATCTAGTATATATTTGTATTGAAATTGAAAGAGTGTCTAGTGTCTAGTCTAGTGTTGCTCCTTGAGGGCCACTATTAGCCCTTTTCCACCAAAGATGTTCCAGAGTCTAGTTCCAAATCGTTTTTTTGTCTTTTGATCCCCAAAGCAAGTAAGTTAGTAAGTTTAAGTAGCATCAAAACTTGTCTTTTGTGCCTGCATCAGAGTCCAGAGTTACAGTGACCAATGACACTGTTTTGTTGTTGTTTTGACACTGTTTTGAACCAAGTTTATTGTAATTAACGAAAATGAATGAAAAAACAAAACTAGAATTGAAAAGCATTTTCTTTAACTGAACTAACCGAAACTGTATTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30078
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 825 1849 17 39
Genomic Location (Zv9):
Chromosome 24 (position 19332872)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18639026
GRCz11 24 18783445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGCTAATTATGCTATAAACACTAAACTTGTCTCCCTTGTCTCCTTAGG[C/T]AAACACTGTTCGCCAGCGCTGACACCGCATACGTTCTTGCGTATTCAATC
Long Flanking Sequence:
GGGTAAAGTGAGCTCCTTATATCTGCCCTAAAATTAGGGCACTTCAGCAGAACAACCCTCAGCCTGAATGACTCGAGATGTGCTAGGAATACTTTAGCAGATCTACATCCAATACATCCTCTGTCTGGATTTCGAGTTACGAAAGACTTTTTCTGCTATTCATTTCACTACCTACGCAATCAATACGGGACTCATTGGCTGTTTTCTTTCAGATCCAGGTAGGAGAGTTTCTAGGAGACAACGACCGCATCAATAAAGAGGTCATGTATGCCTACGTCGACCAAATGGACTTCCAGGGCAAAGACTTCGTGCCAGCGCTGCGCATGTTCCTGGAGGGTTTCCGTCTGCCCGGCGAAGCCCAGAAAATTGATCGACTGATGGAGAAATTTGCTGCTAGATATTTAGAATGCAACCAAGGGTGAGTTTGACGTTTGCGACAGATTAGCCTAAGTTGCTAATTATGCTATAAACACTAAACTTGTCTCCCTTGTCTCCTTAGG[C/T]AAACACTGTTCGCCAGCGCTGACACCGCATACGTTCTTGCGTATTCAATCATCATGTTGACTACCGATCTGCACAGTCCACAGGTTAGTACACAACACACTGATTGATCACTGGAATTTTAGGCGAATGCGGAATTCGTTTTCTTTTATTCTCGAGTCTATGAATTTTAATGCGAATGTCAGTGCTGGAAAGGGCTGTTGGGCGTTCTGTCTTGATATGTAAGCTAACTCTAGGGTGATGGATGTTTCTGAGACGCAACAGAAAACAAGAGGAAGAGCGGTTCTGATCTGTTGTTTCCTTTATCTTGGCACAGGTGAAGAATAAAATGACGAAAGAGCAATACATCAAGATGAATCGAGGTATCAATGACAGTAAAGATTTACCGGAGGAGTATCTCTCAGCCATTTATGATGAAATCGCAGGGAAGAAAATCTCCATGAAGGAGACAAAGGAGTTAACTCTCAAATCAAATAAGCAAAGTGAGTATTCAGAATATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37862
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 884 1849 18 39
Genomic Location (Zv9):
Chromosome 24 (position 19332463)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18638617
GRCz11 24 18783036
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTATCAATGACAGTAAAGATTTACCGGAGGAGTATCTCTCAGCCATTTA[T/A]GATGAAATCGCAGGGAAGAAAATCTCCATGAAGGAGACAAAGGAGTTAAC
Long Flanking Sequence:
CAACCAAGGGTGAGTTTGACGTTTGCGACAGATTAGCCTAAGTTGCTAATTATGCTATAAACACTAAACTTGTCTCCCTTGTCTCCTTAGGCAAACACTGTTCGCCAGCGCTGACACCGCATACGTTCTTGCGTATTCAATCATCATGTTGACTACCGATCTGCACAGTCCACAGGTTAGTACACAACACACTGATTGATCACTGGAATTTTAGGCGAATGCGGAATTCGTTTTCTTTTATTCTCGAGTCTATGAATTTTAATGCGAATGTCAGTGCTGGAAAGGGCTGTTGGGCGTTCTGTCTTGATATGTAAGCTAACTCTAGGGTGATGGATGTTTCTGAGACGCAACAGAAAACAAGAGGAAGAGCGGTTCTGATCTGTTGTTTCCTTTATCTTGGCACAGGTGAAGAATAAAATGACGAAAGAGCAATACATCAAGATGAATCGAGGTATCAATGACAGTAAAGATTTACCGGAGGAGTATCTCTCAGCCATTTA[T/A]GATGAAATCGCAGGGAAGAAAATCTCCATGAAGGAGACAAAGGAGTTAACTCTCAAATCAAATAAGCAAAGTGAGTATTCAGAATATAAACCGTCAAACTTGGAGACAGTAGCAGACAATAGTATGATCAAGTAGTCTCCTACAAAAGCTATGATTGGAAAAATGCTATTTGCTTGCTGGGGTCAGGCAATCCTTTAAAAGTAATTATTATAAAAAATGACTGGGGACTGTGGATTGTCCCACTTACTATTTATTTAATTATTACCGGGAAAAAAAATTGTATTTAACTGTATAATTATTAGGATTTATCATAAAATATTCTAGCAATTGGAAATAATTATTAAAGTAGGTCTGCAATTATTTGTACAATAGTTTTCAGTCAATATTTGTTATAAAAATAAATAAATAAACAATTACAATTTAAGCCAAATTTGGTTTAATTCTCCCCGGTCATTTTTGCCATTTCAGTATTTTCATAAGTTGCGAAAATACCACTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17540
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Essential Splice Site 958 1849 19 39
Genomic Location (Zv9):
Chromosome 24 (position 19330411)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18636565
GRCz11 24 18780984
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCTTCACCAGCGCCACACATCTWGAGCATGTCAGACCAATGTTTAAGG[T/C]AWTCTCTTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTA
Long Flanking Sequence:
AGTACCTGATAGCTCCTCTCTTACTGCTATGTTGGTGATAAATAATCACTTATTTTGATTGGTTGAATAATACACCATCCTGGTATATAAAGTGCACATTCTTTTTTTAATTTTTGTGTAAATGCATCAGTATTTATACTGTAAAATGAATTGGAATAGTGCATTAGTAAGCAAGTTGGGACAGTTCTAGTATTAGTTTTCTATTATAGTTAGAGTAATAATAGTAATAATTAGTGCTGGGCAAAAAAAAATGTTATTAATCAAGTCACCTGACTTTAATAGAGGTATAAGGTGAACACTGCTATTTGGTGTTGATTTTAGTTTTTCTGCTGCTTTCTCTGGATCAGGTGTGGCGAGTGAGAAGCAGAGGAGGCTGCTGTATAATGTTGAGATGGAGCAGATGGCAAAAACAGCAAAGGCTCTGATGGAGGCCGTGAGCCACGTTCAAGCCCCCTTCACCAGCGCCACACATCTTGAGCATGTCAGACCAATGTTTAAGG[T/C]AATCTCTTCATGCACATGGACACTACCATTCAAAGATATTGGGATCAGTAAGATTTTTAAAGGTTTTTAAAAGAAGTTGATTCTGGCTATCAAGGCAGCTTTTTATAAGATTGTGTATAAAGATTGAATATAATTGAGATTGAATATAAAATTATAAGATTGTGCAATATTACTGCAATTTAAAATAACCGTTTCCTTATTGAATGAGGCTTAAACTAATCTATTGATGCGATTTCTGGAAATTTTTTAGCATCACTACAGACTTCTGTGTCAAATGATCCTTCAGAAATCATTCTGCTCAAGAAATATTTAATTATTTTTTAGAAAGTGAAGGAAACACACCAATCAAATGTAAAGGCATTTATTTTGTTAAATACGTATTGTTTTGTGTGTTATTTTTTTAAAATAAATGCTGTTATTTTGATCTTCCCTTTTAACAAGGATTTCTAAAAGGTCGAATGTGTCAGTTTTCACAGAAGCAGGAAAAAAACATGTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa778
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 1167 1849 25 39
Genomic Location (Zv9):
Chromosome 24 (position 19321296)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18627450
GRCz11 24 18771869
KASP Assay ID:
554-0683.1 (used for ordering genotyping assays)
KASP Sequence:
GATGGCTGTGCGCTGTCTCGATGGATGAACTGGCCTCCCCAACACACCCT[C/T]GAATGTTCAGTCTGCAGAAGATCGTGGAGATTTCATACTACAATATGGGT
Long Flanking Sequence:
AACAAATCGCAAACAAGTCTTGTGCTTTATTGCGCCGGGTGTCTGATAGGACCCATAAACTTCATAAACAGACAGCCTTAAACTAGAATTTTGAGAAGAATATTCACACTGATAATTCAAATAAACATGACATTTATTTTGTAACACAGTTTTTTTTATCAAGCATGAAAACAGGTGTTACCTACACCTTCACACACGTACACTTTTTTTTATACCATGAACAGTTAAAGCACTTCTTGAAAAAAAAAAAGAGATAAAAACTCAGTACAGCATTTCTTTTGTGAATAAAAAAAAAATGTTCATAGTTTGCATCATATCAGTATTTTTTTCTGGGATGTGTTCCCATAACCTTGGCATTGTACTGACCGAACTCTTTTAGGTCAGGGAGAATTTAAGTGGCAGTTTATTGATCAATGTTGTGTTTTTTTTTTTTTTTAGTGGACTTTGTGCGATGGCTGTGCGCTGTCTCGATGGATGAACTGGCCTCCCCAACACACCCT[C/T]GAATGTTCAGTCTGCAGAAGATCGTGGAGATTTCATACTACAATATGGGTCGTATCAGGTTGCAGTGGTCCAGGATTTGGGAGGTTATAGGGGATCATTTCAATAAGGTGAGTTCAAAAGCAGCGCTGGAAGGAAATCTCTCTGTGAAGAAATGTGTGGCTTTGCACTATATCAGATAAATCTAATGACGCTTTTAAATTTCACCCTGCCTGCGGGAGACCACGTCTAGTAGATTGAAGAAGAGCCAAAAAATGAAAGTACAGCACAATTGTTGCTTAAAGGGACAAGTCATCCACAGTGGAATATGGGTCAGACTGTAGATGTACTGTAATGTATGAAATATAGTGCATATACTACAGGATATATAGCTAAACACTCCTCTCTATGTAACTGTTTTTACTGAGGTAAATATCATGCATCGTGATATAGTTTGTTTTGTTAATGTTCCCAGTTGAAACACAATCAAAGATTGAGACAGCACATTTTTGGAAAAGGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10355
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 1611 1849 35 39
Genomic Location (Zv9):
Chromosome 24 (position 19301286)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18607440
GRCz11 24 18751859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCYTAATTTGATATTATGTTGTGTGTGTGCATTGTGCAGAAGCTCAGGAA[C/T]AGAGGCTGTTTGCTGCGCTACTCATYAAGTGTGTGGTTCAGCTGGAGCTC
Long Flanking Sequence:
AACAATTCATATTTTTAAAGGTCATATATCTTCAAACTTTACAGTTTTGTTCAAAGGGTTGTTGCCAAAGTGTTTTGTTCATATATACTTTGCCTGATTATGTTTACATTAAATGCACCTTAGTTTACAAAACACTCTGAAAAAGTAACTTTTTATGACTCTTCACAGTGTTTTCTGTATTATATATGTATAAATTGCCCAAAATCCAGTGTGTAAAAACACTTGACTGTATCATGACGATTAAAAGAATGATTTTTGAAACTTTGAACTTTGAAACCGACTTCATCCAGACTGAGATAGAAATGTATGCAAATGAGGAAACAATGTTATCGTTTACATTTAATAATTTTTTGCAAGTTTTTAAAAAGGTTTGCAATCAACTAGGAGGTGTGGTGATAACTGTCAGTTAATGTTTTAACCTATTCACTTGCCTTAACCGTATTTTCTTCAGCCTAATTTGATATTATGTTGTGTGTGTGCATTGTGCAGAAGCTCAGGAA[C/T]AGAGGCTGTTTGCTGCGCTACTCATTAAGTGTGTGGTTCAGCTGGAGCTCATTCAGACCATTGACAACATCGTCTTCTTTCCTGCTACCAGTAAGAAAGAAGATGCGGAAAACTTTGCGGCTGCACAGGTACCAGATTTTATTTTTACTATGTTTCAAAATACACATTAGAAAGTTAAATGAGAACGCGATCAGAACATACAGTTGAAGACAAATATTTCACAAGTGATGACCAAGGAACATTTTCAATCTATTACTTTTCTGGAAAGTCATATTTGTTTTAATTTGTCTGGAATAAAAATATTTATATTTTTATTATTATTATTATTTGTTTTTTTACAGCTAAGTTGAATATTATATTTTTTCAATTTTCTACATAACAAACCACTGTTTTACAATGACTTGCTAATTACTCTAGCTTGCCTAGTTTACCTAATTAACCCAGCTAAGCCTTAAAATTGCACTTTAAGCTGAATACTAGTATCTTTCAAAATAACTAGT
Associated Phenotype:
Not determined