Busch Lab

ZMP

rab43

Ensembl ID:
ENSDARG00000063466
ZFIN ID:
ZDB-GENE-030131-5864
Description:
pre-mRNA-splicing factor ISY1 homolog [Source:RefSeq peptide;Acc:NP_001077032]
Human Orthologue:
ISY1
Human Description:
ISY1 splicing factor homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29201]
Mouse Orthologue:
Isy1
Mouse Description:
ISY1 splicing factor homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923310]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8726 Nonsense Mutation detected in F1 DNA Not yet available
sa44734 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27699
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093148 Essential Splice Site 1 285 1 11
Genomic Location (Zv9):
Chromosome 11 (position 473047)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 459784
GRCz11 11 486282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTCAGCGTTGAGTTCACGCAGGATTGAAGATCTGAACTTCAAACATGG[T/G]AAAGAAACATTTTCCTGGCTTATTATTAATTTAATATCATACTAGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8726
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093148 Nonsense 29 285 4 11
Genomic Location (Zv9):
Chromosome 11 (position 470735)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 457472
GRCz11 11 483970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCYGAWATCATGCATTTACCTGATCWAATGTCGTACATCCACAGGAGAGA[C/T]GACCTTACCTTGCCTCAGAGTGTAATGAGCTGCCCAAAGCAGAGAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44734
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093148 Nonsense 118 285 7 11
Genomic Location (Zv9):
Chromosome 11 (position 468731)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 455468
GRCz11 11 481966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTGGGCCGAAGATGTTGGACCATGAGGGTAAAGAGGTTCCTGGAAAC[A/T]GAGGATACAAGTATTTCGGCGCTGCCAAAGATTTACCTGGAGTTCGAGAG
Associated Phenotype:
Not determined