Busch Lab

ZMP

RPH3A (2 of 2)

Ensembl ID:
ENSDARG00000063436
Description:
rabphilin 3A homolog (mouse) [Source:HGNC Symbol;Acc:17056]
Human Orthologue:
RPH3A
Human Description:
rabphilin 3A homolog (mouse) [Source:HGNC Symbol;Acc:17056]
Mouse Orthologue:
Rph3a
Mouse Description:
rabphilin 3A Gene [Source:MGI Symbol;Acc:MGI:102788]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24863 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9918 Essential Splice Site Available for shipment Available now
sa41577 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4355
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Essential Splice Site 164 597 5 16
Genomic Location (Zv9):
Chromosome 10 (position 3503403)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3495597
GRCz11 10 3495901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGATCTGATAGTTTTTCTTTCCATCCTGGGATAATTGCCTTGCATTTC[A/G]GAAAGCGTTCAGGTCACCGGCAGAGAGCAGCAGATATCTGGTAAGTGTCC
Long Flanking Sequence:
CCTTCATCATTTTAAATGAACTAATATTAGTTCTTCAGTCCAACATCTAAATTAGCCCCCAAAAAGTATTGAACACACGAAGAAAGGAAGGTGTAGAAAGGCAGTGAAAGCCCAGACAGCAGCTGAAATCTCTCAGTAGTTCTTCAGCAACCCTCTGCCCTTCATCATTTTAAATGAACTAATATTAGTTCTTCAGTCCAACATCTAAATTAGCCCCCACCCACCCCCCAAGAAACATACATGTATAATGGGAACAGTATAACAGGAAAACTTTAGAAAAGTTTTCCAAACCACTGTAAACCTTGAAACCTCTTATCATCCCATGCCCACTTTCCAGTTTAGAACTGATTTGCAAATTACACATTAAAAATTCTGAATACTGTGCAGTTTTCATGCATTTTGCCTTAGGCTTGGGTAATTTATTGTAATGTTTTCATAACTCACGATTCAAAGGATCTGATAGTTTTTCTTTCCATCCTGGGATAATTGCCTTGCATTTC[A/G]GAAAGCGTTCAGGTCACCGGCAGAGAGCAGCAGATATCTGGTAAGTGTCCCGCATTTCAATAACATTTAATATCAGCAAGAGGAAATGAGGCATAAGATGAATCACGCAGTATCATTTACTCGCTTTCTCCCATGCTCAGCAGAAACCATGCCCGCTAAACGGGAAGAGCGTTCTGTCATATCCCAAAGAGCCCTAGAGGAGGACGGAGGGAGACACAGGAGCACGGTTCAGTCCGACGCCGCAATGGAAGGACAAACTTTCTCACCTGTGGTCAAGCGAGAAGTGCCGGTGCAGAGTTCCAGACCTCCAGCGTCCAGCTTTTCCACAACTCCAATACAAAAAGGTGAGAGAATTTATCATGTAGTGGTTATGATTCAGCATGGACAACTGCATGTCATTACACACACACACTTGTTTCTATATCCAAGTGGGGACTCTCATATATGTAATTATATTTTTACAATACAAAACATACAGTTGAAACCAGAAGTTTACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Essential Splice Site 177 597 5 16
Genomic Location (Zv9):
Chromosome 10 (position 3503445)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3495639
GRCz11 10 3495943
KASP Assay ID:
554-7443.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATTTCAGAAAGCGTTCAGGTCACCGGCAGAGAGCAGCAGATATCTGG[T/C]AAGTGTCCCGCATTTCAATAACATTTAATATCAGCAAGAGGAAATGAGGC
Long Flanking Sequence:
ACATCTAAATTAGCCCCCAAAAAGTATTGAACACACGAAGAAAGGAAGGTGTAGAAAGGCAGTGAAAGCCCAGACAGCAGCTGAAATCTCTCAGTAGTTCTTCAGCAACCCTCTGCCCTTCATCATTTTAAATGAACTAATATTAGTTCTTCAGTCCAACATCTAAATTAGCCCCCACCCACCCCCCAAGAAACATACATGTATAATGGGAACAGTATAACAGGAAAACTTTAGAAAAGTTTTCCAAACCACTGTAAACCTTGAAACCTCTTATCATCCCATGCCCACTTTCCAGTTTAGAACTGATTTGCAAATTACACATTAAAAATTCTGAATACTGTGCAGTTTTCATGCATTTTGCCTTAGGCTTGGGTAATTTATTGTAATGTTTTCATAACTCACGATTCAAAGGATCTGATAGTTTTTCTTTCCATCCTGGGATAATTGCCTTGCATTTCAGAAAGCGTTCAGGTCACCGGCAGAGAGCAGCAGATATCTGG[T/C]AAGTGTCCCGCATTTCAATAACATTTAATATCAGCAAGAGGAAATGAGGCATAAGATGAATCACGCAGTATCATTTACTCGCTTTCTCCCATGCTCAGCAGAAACCATGCCCGCTAAACGGGAAGAGCGTTCTGTCATATCCCAAAGAGCCCTAGAGGAGGACGGAGGGAGACACAGGAGCACGGTTCAGTCCGACGCCGCAATGGAAGGACAAACTTTCTCACCTGTGGTCAAGCGAGAAGTGCCGGTGCAGAGTTCCAGACCTCCAGCGTCCAGCTTTTCCACAACTCCAATACAAAAAGGTGAGAGAATTTATCATGTAGTGGTTATGATTCAGCATGGACAACTGCATGTCATTACACACACACACTTGTTTCTATATCCAAGTGGGGACTCTCATATATGTAATTATATTTTTACAATACAAAACATACAGTTGAAACCAGAAGTTTACACACACTGTATAAAAGGCACATGATTTAAAATAAAGTCAGATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9918
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Essential Splice Site 243 597 6 16
Genomic Location (Zv9):
Chromosome 10 (position 3503748)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3495942
GRCz11 10 3496246
KASP Assay ID:
2260-2779.1 (used for ordering genotyping assays)
KASP Sequence:
GAGTTCCAGACCTCCAGYRTCCAGCTTTTCCACAACTCCAATACAAAAAG[G/T]TGAGAGAATTTATCATGTAGTGGTTATGATTCAGCATGGACAACTGCATG
Long Flanking Sequence:
TGATTTGCAAATTACACATTAAAAATTCTGAATACTGTGCAGTTTTCATGCATTTTGCCTTAGGCTTGGGTAATTTATTGTAATGTTTTCATAACTCACGATTCAAAGGATCTGATAGTTTTTCTTTCCATCCTGGGATAATTGCCTTGCATTTCAGAAAGCGTTCAGGTCACCGGCAGAGAGCAGCAGATATCTGGTAAGTGTCCCGCATTTCAATAACATTTAATATCAGCAAGAGGAAATGAGGCATAAGATGAATCACGCAGTATCATTTACTCGCTTTCTCCCATGCTCAGCAGAAACCATGCCCGCTAAACGGGAAGAGCGTTCTGTCATATCCCAAAGAGCCCTAGAGGAGGACGGAGGGAGACACAGGAGCACGGTTCAGTCCGACGCCGCAATGGAAGGACAAACTTTCTCACCTGTGGTCAAGCGAGAAGTGCCGGTGCAGAGTTCCAGACCTCCAGCGTCCAGCTTTTCCACAACTCCAATACAAAAAG[G/T]TGAGAGAATTTATCATGTAGTGGTTATGATTCAGCATGGACAACTGCATGTCATTACACACACACACTTGTTTCTATATCCAAGTGGGGACTCTCATATATGTAATTATATTTTTACAATACAAAACATACAGTTGAAACCAGAAGTTTACACACACTGTATAAAAGGCACATGATTTAAAATAAAGTCAGATGTTAATTTGACTAAACTTTTTCTCTTTTAGGTAAGTTTGGATTATTATATTGTTTCTGCTTAATAGCAGAATAACGAGAGAGATATTGTTTGAAAAATTTGGTAATTTGAAAGTCATGTTTACATATAAGATTATTCTGCCTCTGAAAAAGCTCAGATGATGGTGTCAAGGTTTTGAAAGTTTCTGACTGGCTAATTGACAACATTTGAGTTAGCTGGAGGCACAACTGTAGAATAGCATTTAAGGAAAACCTCAAACACACTGCTTCCTAGTGTGACAACATGGGAAAATCAACAAGCCAGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41577
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Nonsense 487 597 13 16
Genomic Location (Zv9):
Chromosome 10 (position 3515380)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3507574
GRCz11 10 3507878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGTGTCGTCCGATGTGCTCATCTGGCAGCAATGGACTCCAATGGCTA[T/A]TCAGACCCGTTTGTAAAGATGTAAGGAACTCTAACACGATCTAATTCGAA
Long Flanking Sequence:
TTGGGGCGAGGCAGTGGCGCAGTAGGTAGTGCTGTCGCTTCACAGCAAGAAGGTTGCTGGTTCGAGCCTCAGCTCAGTTGACGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCCTGCTGGTCATCTCCCACCCTCTCCAGCTAAGACCAGGCTGGAAATGGCTGGAAACCAGCCTGGAAGTGGCCAAAACCCCTCTAAAACCAGCCTGGTCAACCAGCTAAAGCAAGCCAACCAGCTTAGGCTGGTTTAAGCTGTTTTTTTCAGTAGGGCATCAGGCATGTATTTCCAGTTTTCCTCGGTTGGGTTTGAATAATTGCAAAAAGCATCGTCATAAATGAGGGCTTCACTCATATTACGTGTGGCTTTTTTAGTTGAAGGATGATGAAGCAGAGGAAAGAGGACGGATCCTGGTTTCCCTCACCTACAACAGTCAACAAGGTCGTCTGATCGTGGGTGTCGTCCGATGTGCTCATCTGGCAGCAATGGACTCCAATGGCTA[T/A]TCAGACCCGTTTGTAAAGATGTAAGGAACTCTAACACGATCTAATTCGAAATCAGAAGCAGATTCACTGAAAGCAGTTCTCTAAGTGTGATTAAAACGTTCTCTGTGTTCATCGTTCGCATGGTGGTGTTGTTTTGTGGCGCTCATTAGGCTTGTTTAATGATCACAAAAGCGCCTTTGAATTCTTGTGCTGTTTTGCAGTTGCTTGAAGCCTGACATGGGAAAGAAAGCGAAGTACAAGACTCAGATCAAAAAGAAGACCCTTAACCCTGAGTTTAATGAGGTACTCTTTCTTTCTCTTCATGTCTGGCGATGTGACCTGCAGGGAACGTTTTGAAGCATGACACTGATGTGCTTCCGTCACAGTGCTTTCATATGCTTTTCTTGACATGCATCATGGGAAATGTCATGCTTCCTTTGTTGTTGTTGTCATGTTAAAATATATTTGTTTGATTACAGGAGTTCAGCTATGAAATCAAGCATGGTGAACTGGCCAAGAAG
Associated Phenotype:
Not determined