Busch Lab

ZMP

zgc:152925

Ensembl ID:
ENSDARG00000063385
ZFIN ID:
ZDB-GENE-060929-860
Description:
hypothetical protein LOC767754 [Source:RefSeq peptide;Acc:NP_001070189]
Human Orthologue:
CENPE
Human Description:
centromere protein E, 312kDa [Source:HGNC Symbol;Acc:1856]
Mouse Orthologue:
Cenpe
Mouse Description:
centromere protein E Gene [Source:MGI Symbol;Acc:MGI:1098230]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa24832 Nonsense Mutation detected in F1 DNA Not yet available
sa32570 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19390 Nonsense Available for shipment Available now
sa32571 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24832
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584 None 21 317 3 10
ENSDART00000111806 Nonsense 66 2690 3 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 None None 170 None 4
ENSDART00000148261 None None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 137422)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 267552
GRCz11 1 262731
KASP Assay ID:
554-7286.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCTCGTGTGTTTCAGACCGTGTGTTCAGTGCGGCAGAGTCCACTGCT[C/T]AACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGTTGAAGGT
Long Flanking Sequence:
TGACTTTGGAAACAGTGTAAAATCCCTGTCTAACACTGACTAGAAGAAATTCCTTTTCTTACTTGAAGTCTTGTTTCCAGTCCAAATGTTTTTAAAAAATCTAGACAAGCAAAAAATATTTTCTTGTTTTAATAAATGAAATAATGATGATGTTGATAATATTAATAATAATAATCATCTGCTAATGGGGTAAGCGAAATAATCTTGTTTTTGCATTGAAATAACATTTAGCTTACCCAATTAACAAATTATTTAGCTTGTTTTAATGTAAAGCTCACTTAATTCCTGAAAACAAGACAATATCTTTTCTAGTCTATTTATTATTAAGATAATATTATTATTATCATCATTATTATTATTATTATTATTTGGACTAGAAACAATACAGATTCTAAGTAAGAAAACAATCTTTTGCAGTGTGCTTTGACTTTGGCTAGCAGGTTAATGCGCTGTCCTCGTGTGTTTCAGACCGTGTGTTCAGTGCGGCAGAGTCCACTGCT[C/T]AACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGTTGAAGGTTATAACGGTGAGTCCAGAAATGAAGATTTATTTTTTCCAGCACAGCAAAGCACAGACACACGGGTGATTTACTGAAATGTAGGGTTGAATGATCCAGAGTACAATAACGTGACAAATAAAAATGATAACAGTAGATAAATGAAAGACCTTAAAGACTAAATAGATTTTAAAAGGGTTATTTTTTTCATGAATGTTTCAGGAAAGTTGTTCTGTTTTAAAAAGGCAAGAAAAAAAACACTCCAAGCATATATTATTATACACATGTCTCGTCTTTCATGAGGTCAGATATTTGCCTTCCTTAGTAGCTTTCTGTATCAAATTACACTAGCATGTGTTTTCATCTACAAGGAAAGATTATTAAAGTGAAAAATAATCCTGAAATGCTGTAAATTGCACTGTATTTTGTGTATTTGTATACTGCATATACAGTATACTCTTAAATGTAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584 Essential Splice Site 35 317 3 10
ENSDART00000111806 None 80 2690 3 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 None None 170 None 4
ENSDART00000148261 None None 199 None 4
ENSDART00000092584 Essential Splice Site 35 317 None 10
ENSDART00000111806 None 80 2690 3 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 None None 170 None 4
ENSDART00000148261 None None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 137466)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 267596
GRCz11 1 262775
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCTCAACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGT[T/A]GAAGGTTATAACGGTGAGTCCAGAAATGAAGATTTATTTTTTCCAGCACA
Long Flanking Sequence:
AGAAATTCCTTTTCTTACTTGAAGTCTTGTTTCCAGTCCAAATGTTTTTAAAAAATCTAGACAAGCAAAAAATATTTTCTTGTTTTAATAAATGAAATAATGATGATGTTGATAATATTAATAATAATAATCATCTGCTAATGGGGTAAGCGAAATAATCTTGTTTTTGCATTGAAATAACATTTAGCTTACCCAATTAACAAATTATTTAGCTTGTTTTAATGTAAAGCTCACTTAATTCCTGAAAACAAGACAATATCTTTTCTAGTCTATTTATTATTAAGATAATATTATTATTATCATCATTATTATTATTATTATTATTTGGACTAGAAACAATACAGATTCTAAGTAAGAAAACAATCTTTTGCAGTGTGCTTTGACTTTGGCTAGCAGGTTAATGCGCTGTCCTCGTGTGTTTCAGACCGTGTGTTCAGTGCGGCAGAGTCCACTGCTCAACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGT[T/A]GAAGGTTATAACGGTGAGTCCAGAAATGAAGATTTATTTTTTCCAGCACAGCAAAGCACAGACACACGGGTGATTTACTGAAATGTAGGGTTGAATGATCCAGAGTACAATAACGTGACAAATAAAAATGATAACAGTAGATAAATGAAAGACCTTAAAGACTAAATAGATTTTAAAAGGGTTATTTTTTTCATGAATGTTTCAGGAAAGTTGTTCTGTTTTAAAAAGGCAAGAAAAAAAACACTCCAAGCATATATTATTATACACATGTCTCGTCTTTCATGAGGTCAGATATTTGCCTTCCTTAGTAGCTTTCTGTATCAAATTACACTAGCATGTGTTTTCATCTACAAGGAAAGATTATTAAAGTGAAAAATAATCCTGAAATGCTGTAAATTGCACTGTATTTTGTGTATTTGTATACTGCATATACAGTATACTCTTAAATGTAATTCAATGTATTTTGCACTGTGTTTAGCCTGCACTCAAGCTTTTCCCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2023
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584 Essential Splice Site 35 317 3 10
ENSDART00000111806 None 80 2690 3 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 None None 170 None 4
ENSDART00000148261 None None 199 None 4
ENSDART00000092584 Essential Splice Site 35 317 None 10
ENSDART00000111806 None 80 2690 3 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 None None 170 None 4
ENSDART00000148261 None None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 137466)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 267596
GRCz11 1 262775
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGCTCARCTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGT[T/C]GAAGGTTATAACGGTGAGTCCAGAAATGAAGATTTATTTTTTCCAGCACA
Long Flanking Sequence:
AGAAATTCCTTTTCTTACTTGAAGTCTTGTTTCCAGTCCAAATGTTTTTAAAAAATCTAGACAAGCAAAAAATATTTTCTTGTTTTAATAAATGAAATAATGATGATGTTGATAATATTAATAATAATAATCATCTGCTAATGGGGTAAGCGAAATAATCTTGTTTTTGCATTGAAATAACATTTAGCTTACCCAATTAACAAATTATTTAGCTTGTTTTAATGTAAAGCTCACTTAATTCCTGAAAACAAGACAATATCTTTTCTAGTCTATTTATTATTAAGATAATATTATTATTATCATCATTATTATTATTATTATTATTTGGACTAGAAACAATACAGATTCTAAGTAAGAAAACAATCTTTTGCAGTGTGCTTTGACTTTGGCTAGCAGGTTAATGCGCTGTCCTCGTGTGTTTCAGACCGTGTGTTCAGTGCGGCAGAGTCCACTGCTCAACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGT[T/C]GAAGGTTATAACGGTGAGTCCAGAAATGAAGATTTATTTTTTCCAGCACAGCAAAGCACAGACACACGGGTGATTTACTGAAATGTAGGGTTGAATGATCCAGAGTACAATAACGTGACAAATAAAAATGATAACAGTAGATAAATGAAAGACCTTAAAGACTAAATAGATTTTAAAAGGGTTATTTTTTTCATGAATGTTTCAGGAAAGTTGTTCTGTTTTAAAAAGGCAAGAAAAAAAACACTCCAAGCATATATTATTATACACATGTCTCGTCTTTCATGAGGTCAGATATTTGCCTTCCTTAGTAGCTTTCTGTATCAAATTACACTAGCATGTGTTTTCATCTACAAGGAAAGATTATTAAAGTGAAAAATAATCCTGAAATGCTGTAAATTGCACTGTATTTTGTGTATTTGTATACTGCATATACAGTATACTCTTAAATGTAATTCAATGTATTTTGCACTGTGTTTAGCCTGCACTCAAGCTTTTCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19390
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584 None None 317 None 10
ENSDART00000111806 Nonsense 389 2690 13 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 None None 170 None 4
ENSDART00000148261 None None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 142648)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 272778
GRCz11 1 267957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGACTCAAACCACAGCGACCGAGCGAGAGTCTCTCTGTCAGCTCCTG[C/T]AGGAGAAAGACCAGCTCCAGAGAGAGCAGGAGGACCGCATCAAGAACTTG
Long Flanking Sequence:
TGTCAGGGACGGACTGTACCTTGTGTTCGTTTCATACAAAAAACAAAACCGGAGAACAATTGTTTATTAAGCCAAAAACATCTGTTTGTAGTTTGTTTAAGAGTAGGGGTTTGAAGCTTTCAGTGGATATATTTCTCCCGTGTTTGAAGCATGTATTGGCTGAGATTCCAGTGTGTTTGCTGACCCCAGAGCATTCATAATGAAGCTGCAGAAACTGTCCTAAACACATGTCTGCACTGAGACCCTCCCCTGGAGAATCCTCACTCTATAGTGATCAATGATTGGCTCCTGCACCAGAATGCAGGACTTTACTAGCCATATTGACTGTTAACACATTTTTCCCATTCAGAACTGTACGAGTGGCTTGTCTTGTGTATTCTAGTGTTTGTCATAACTCAACCCATCCTCTCCTCTCCTCATGTGTTTCACTCCTGACTGCACAGGTTTCGTCTGTGACTCAAACCACAGCGACCGAGCGAGAGTCTCTCTGTCAGCTCCTG[C/T]AGGAGAAAGACCAGCTCCAGAGAGAGCAGGAGGACCGCATCAAGAACTTGACCAAGTTACTGGTTACTTCCTCCAACATTGCGCTCATCCCGAAGGTAACAGATGACAGCAGTTTACTCAGAACCTTTGTTTCTTTCTTCTGTTGAACACAAATGAAGATATTTTAAAGAAAGTTGGAAACCTGTAACCATTGACTTCCAGAGTTTTAGTTTTTTTCTACTATGGAAGTCGATGGTTACAAGTTTTCAGCATTCTTCAAAATATCTTAAACTGGTTTGGAAACACTCGAGGATGAGTGAATAGCGAATACATTTTTGCCTGATCTTTCCCTTTAAAGTCAAAGTTTGCAGTGTTTATTTTGGTAGCTCGCGTTATTATTTTAAATGGAATAATCTGTGCGAGGTCATCCACTGACATTTTGTTTTGGTAATCTTAAAGTTTGATCATTTGTGTTACTTTAACTACTGTTAGATGCATGAACGCGCTGTTTATTTTAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32571
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584 None None 317 None 10
ENSDART00000111806 Nonsense 561 2690 16 58
ENSDART00000133431 None None 171 None 5
ENSDART00000148172 Nonsense 125 170 4 4
ENSDART00000148261 None None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 144437)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 274567
GRCz11 1 269746
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGAAGCTCTCGCATCTGCAGAACATGCTGGAGGCTCAGTCTGCACCAT[C/A]ACACGAGGAGAAAAACACCATCTCTGAGCTGGAGAAGCAGATGGAGGATC
Long Flanking Sequence:
AGTTTGTGCTTTTCTTGAATTATATAATACTGTGTTGTAATTTTGTTGTTGTGTTCAGATATGGATGAGTTTGACAGCCGCTTCGACTTCACTGCTATGGAGGAACCCAACATGGACATGGAGATGAGCAGCATCACTGTCCGCAGCTCCTCGGAGGGGTGAGAAAAAGCTCTATTAGGTTTAAAATAGCTCTTATGTCCAGTGTTGTTCATATTTATGATTGTTTATTTATGTAGCATCGTGTTCCTGTGAGACAGAGTTTTATTCCACTGTATGTCCACTTGTAGTGCAATGACAGTAAACCTCATCTTCATTTCCTCTGTTCAGGAGTCATTTTCTGGACTCTCCCCGTGCGAGCGAGCTGATGCAGAAGGTGTCGTCTCTGGAGAGTCAGCTGGAGGCCGAGACTCAGAGCAAACAGATAGCAGAAGAGATGAACGCTGAGCTCCAGATGAAGCTCTCGCATCTGCAGAACATGCTGGAGGCTCAGTCTGCACCAT[C/A]ACACGAGGAGAAAAACACCATCTCTGAGCTGGAGAAGCAGATGGAGGATCTGCAGCGGAGACTGGAGACGGAGGTTCAAGAGAGACAAACCGCTGAGGAGAAGAGCATCTCACTGGAGCTGAAGGTGGCAGAGCTGGAGAAACCATCAGAAGAGCTGCTGCACTCACAGAACACGTGCGAACGGGTACAGCTGCTAATACTACAGCTTATGCAGTGTCTGCCCATCTGCTTTCACTCTGGAACAGCAGTCCATTGACCCTAACTGGGTGAAATATGCTTAGCCACGCCCCTTCCCCAGTATGCTGCGAGTGCAATATGCAGTCTTTTTATTATTTTTTGTTATTACCTGCCTATTATTAAGATATTAAGTGTACATTAGTAGTTATACATAATCTCATTCTGCAACTCAAAACCTAAACCAAACTTCTACCTTATTAATTAAAGGTTTAATAATGTAATCTATTAAGCTAGTAGTGTTTGTTAATGCCAGGAGTTGAGAC
Associated Phenotype:
Not determined