Busch Lab

ZMP

tjp2a

Ensembl ID:
ENSDARG00000063309
ZFIN ID:
ZDB-GENE-070925-2
Human Orthologue:
TJP2
Human Description:
tight junction protein 2 (zona occludens 2) [Source:HGNC Symbol;Acc:11828]
Mouse Orthologue:
Tjp2
Mouse Description:
tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13709 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4364
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 432 1198 7 22
ENSDART00000136789 Nonsense 432 1198 9 24
Genomic Location (Zv9):
Chromosome 10 (position 15863527)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15876834
GRCz11 10 15834953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNTGCAGACATCTCTGAGATCGAGTCGTACCGCTCATATTCTCCT[C/T]AGGAGGATCGGCGGAGTCATCACTCAGACCTCTCCTCACACTCCTCCAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27581
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Essential Splice Site 456 1198 8 22
ENSDART00000136789 Essential Splice Site 456 1198 10 24
Genomic Location (Zv9):
Chromosome 10 (position 15859811)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15873118
GRCz11 10 15831237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACAGAAAACTGTGTAGAGTTTAACTCCCTTTTTGCTTCTTTTCCTTGT[A/T]GAGAAGAGCCTCCTAAAAGACTGGCTAAAATGGGAGCGATGCCCACTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18981
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
Genomic Location (Zv9):
Chromosome 10 (position 15858460)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15871767
GRCz11 10 15829886
KASP Assay ID:
2260-3033.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTTCAAGAGGACAGTCCTGCCGAGGTGGAGGGTCTGCGCACTGGAGAC[C/T]AAATAGTCAAGGTCAGGATTGCACGCTGCACAAGGCGAAATTGCGTGCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4337
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
Genomic Location (Zv9):
Chromosome 10 (position 15858460)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15871767
GRCz11 10 15829886
KASP Assay ID:
2260-3033.1 (used for ordering genotyping assays)
KASP Sequence:
GCGTTCAAGAGGACAGTCCTGCCGAGGTGGAGGGTCTGCGCACTGGAGAC[C/T]AAATAGTCAAGGTCWGGATTGCACGCTGCACAAGGCGAAATTGCGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13709
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 831 1198 16 22
ENSDART00000136789 Nonsense 831 1198 18 24
Genomic Location (Zv9):
Chromosome 10 (position 15855121)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15868428
GRCz11 10 15826547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCTGGATGTCACTCCAAAGGCTGTAGACACCCTCAATTACACTCAGTG[G/A]TATCCCATTGTCATCTTCCTCAACCCAGACAGCAAGCAGGGGGTGAAGAC
Associated Phenotype:
Not determined