Busch Lab

ZMP

Q1RLV3_DANRE

Ensembl ID:
ENSDARG00000063300
Description:
LOC567075 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLV3]
Human Orthologue:
SEC16A
Human Description:
SEC16 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:29006]
Mouse Orthologue:
Sec16a
Mouse Description:
SEC16 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2139207]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25033 Nonsense Mutation detected in F1 DNA Not yet available
sa39130 Nonsense Mutation detected in F1 DNA Not yet available
sa12789 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25033
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Nonsense 131 1097 3 26
Genomic Location (Zv9):
Chromosome 16 (position 55590515)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52080659
GRCz11 16 51937566
KASP Assay ID:
554-7564.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGCAGCCTACGATGCCACTGGCACCACTCTTCCAGCAGATTACACCTA[C/A]AGCCAGTATCCTAACCCTTCAGATACTGTGAATTATGGTCAGGATCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39130
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Nonsense 617 1097 15 26
Genomic Location (Zv9):
Chromosome 16 (position 55564860)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52056317
GRCz11 16 51913682
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCCGATCATCTGCATGGTATTGTCCCATTCAGGAGGGTGTGATCTCTT[T/A]GCGTACGGACCGCAGCACCCCACAGCTTTACCCCTGCAGTACACCCAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3948
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Essential Splice Site 670 1097 15 26
Genomic Location (Zv9):
Chromosome 16 (position 55564700)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52056157
GRCz11 16 51913522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATGACCTCTCTTGTGCCCCCAGCTGCTGTACAACYCATGCCTCCAGG[T/C]ATGACAGGAGTATAATGTGAACTCAGGAAAAAAATATAATTTCATYCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Essential Splice Site 956 1097 21 26
Genomic Location (Zv9):
Chromosome 16 (position 55559349)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52050806
GRCz11 16 51908171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCGGCCCACCATCAGGGCCTCCTGTGAACATGTTCTCCARAAGAGCAGG[T/A]GCCGTTACCAGGAATTATACCTCTTTTACCCTYCTAAYCACTTAYGGAAA
Associated Phenotype:
Not determined