Busch Lab

ZMP

si:dkey-108d22.4

Ensembl ID:
ENSDARG00000063299
ZFIN ID:
ZDB-GENE-030131-8115
Description:
Novel protein similar to vertebrate piccolo (Presynaptic cytomatrix protein) (PCLO) [Source:UniProtK
Human Orthologue:
BSN
Human Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:
Bsn
Mouse Description:
bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 19 alleles of this gene:

Allele Name Consequence Status Availability
sa26245 Nonsense Mutation detected in F1 DNA Not yet available
sa26246 Nonsense Mutation detected in F1 DNA Not yet available
sa9380 Nonsense Mutation detected in F1 DNA Not yet available
sa1417 Nonsense Available for shipment Available now
sa33409 Nonsense Mutation detected in F1 DNA Not yet available
sa33410 Nonsense Mutation detected in F1 DNA Not yet available
sa33411 Nonsense Mutation detected in F1 DNA Not yet available
sa33412 Nonsense Mutation detected in F1 DNA Not yet available
sa40241 Nonsense Mutation detected in F1 DNA Not yet available
sa17573 Nonsense Available for shipment Available now
sa33413 Essential Splice Site Available for shipment Available now
sa20227 Nonsense Available for shipment Available now
sa11716 Nonsense Available for shipment Available now
sa20228 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26245
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 24 4152 1 32
ENSDART00000136117 None None 3096 None 15
ENSDART00000143963 None None 3298 None 20
Genomic Location (Zv9):
Chromosome 4 (position 10451602)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11388229
GRCz11 4 11387078
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAAAGGGTCCTCCTCAAGGGAGTAAGCCACCTCAGCAGGGTCCCCCT[A/T]AAGGGCAGGGACCTCTTCAGCAAGGGCCCAAACCTGGTGGACCAGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26246
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 335 4152 2 32
ENSDART00000136117 None None 3096 None 15
ENSDART00000143963 None None 3298 None 20
Genomic Location (Zv9):
Chromosome 4 (position 10453284)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11389911
GRCz11 4 11388760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACCACAGCAGGGACCTCAGCCTGGACAACTAGGGGCAAAACGTGGA[C/T]AGCCTCCACCACTTCAGAAACCTTCACAGAGCCCAAAAGGTAGTCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9380
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1261 4152 10 32
ENSDART00000136117 Nonsense 409 3096 1 15
ENSDART00000143963 Nonsense 409 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10480040)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11416667
GRCz11 4 11415516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGARCTAAGACAGGARGCAGAAATGGAGGAAATCCGCAGGTCTTCCTG[C/A]TCAGACCTCTCCCCAAGCATRGATTCAGAACCAGAGAGTTTTGAGMTWCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1417
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1878 4152 10 32
ENSDART00000136117 Nonsense 1026 3096 1 15
ENSDART00000143963 Nonsense 1026 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10481889)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11418516
GRCz11 4 11417365
KASP Assay ID:
554-1338.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAGCAGTCACAAACAACTAGAGTACCACTGGCATTCACACGGATAACT[G/T]AATCTATTGAAAGTCAAGAAATTTGTGGTCCAGAGAAAGTAGTTTCTAGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1968 4152 10 32
ENSDART00000136117 Nonsense 1116 3096 1 15
ENSDART00000143963 Nonsense 1116 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10482161)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11418788
GRCz11 4 11417637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAAACTACTAAACCTGAAGCAGTTCAAATACAGAATGGTCATGCCTA[T/A]CATCCTGGTGAAGTAGTGGATCTCCGAACCCCAAAAATAGATGCAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33410
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 1996 4152 10 32
ENSDART00000136117 Nonsense 1144 3096 1 15
ENSDART00000143963 Nonsense 1144 3298 1 20
Genomic Location (Zv9):
Chromosome 4 (position 10482243)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11418870
GRCz11 4 11417719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAAATAGATGCAGTAACATCCATGAAAGGTATAGATCTGTCTTCCTCT[G/T]AATCAAGGCGACAGTCTCTTGCTGTTGATAGTGGTGGACGTCAACAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33411
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 2465 4152 11 32
ENSDART00000136117 Nonsense 1613 3096 2 15
ENSDART00000143963 Nonsense 1613 3298 2 20
Genomic Location (Zv9):
Chromosome 4 (position 10483917)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11420544
GRCz11 4 11419393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGAAAATAAAGCAGCAGCGCTTAGCTGAAGAGCTTGAGTGGGAGAGG[C/T]AGGAGATACAGCGTTTCCGTGAGCAGGAGCAACTTCTTGTGCAGAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33412
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 2514 4152 11 32
ENSDART00000136117 Nonsense 1662 3096 2 15
ENSDART00000143963 Nonsense 1662 3298 2 20
Genomic Location (Zv9):
Chromosome 4 (position 10484064)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11420691
GRCz11 4 11419540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAGAGACAAGCCCACCTAATGATGCAAAAGGAAACTTATGCGCAG[C/T]AACAGGAACAGTTAGAGCAGATCCAAAGACTTCAGGAACAGCTGAGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40241
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3009 4152 12 32
ENSDART00000136117 Nonsense 2157 3096 3 15
ENSDART00000143963 Nonsense 2157 3298 3 20
Genomic Location (Zv9):
Chromosome 4 (position 10486088)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11422715
GRCz11 4 11421564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAACAGAGCTACCACCAAATGCTCTTGCTCCAGCAGAAAGCCAGACAA[C/T]AAGCTGCTCTCCTCTCTGAATTAGATTCTACAAAAATTGCATCTAGCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26247
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3137 4152 12 32
ENSDART00000136117 Nonsense 2285 3096 3 15
ENSDART00000143963 Nonsense 2285 3298 3 20
Genomic Location (Zv9):
Chromosome 4 (position 10486472)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11423099
GRCz11 4 11421948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAGACTACCTGGGCAGCTCTTCCAGGCTCCATTCCTATGGTAAGGCC[C/T]AAGATGAAGAGGACCCAATGGAAGAGCCATTTGAACTGAAGCTTTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17573
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3358 4152 13 32
ENSDART00000136117 Nonsense 2514 3096 3 15
ENSDART00000143963 Nonsense 2514 3298 3 20
Genomic Location (Zv9):
Chromosome 4 (position 10487160)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11423787
GRCz11 4 11422636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAGCAGAAGGTGAAGCCTCTTCTGAGACCTCAGCATTCCAGACTCCCT[C/A]GGGCAGGTCAAAACCTACAAGCCTCCCYATTGTACAAAGTGGGCGTGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2186
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3419 4152 13 32
ENSDART00000136117 Nonsense 2575 3096 3 15
ENSDART00000143963 Nonsense 2575 3298 3 20
Genomic Location (Zv9):
Chromosome 4 (position 10487343)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11423970
GRCz11 4 11422819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGGTCCACTCCCACCCATATCTGCAGACTCTCGTGATCAGTTTGGAT[C/A]ATGCATGTCTCTACAAGAATCTCAACAGCAACATCTCAGAGAAGATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33413
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Essential Splice Site 3508 4152 15 32
ENSDART00000136117 Essential Splice Site 2642 3096 5 15
ENSDART00000143963 Essential Splice Site 2642 3298 5 20
Genomic Location (Zv9):
Chromosome 4 (position 10490468)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11427095
GRCz11 4 11425944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTACAAAGATTGTAAAGAAATATTTGTCTGAATGTGCTTATGCATCTTT[A/G]GGGAAAGTTTCACTACCCGTTTCCTCATGCAAGAATAAAACTACTGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20227
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3566 4152 16 32
ENSDART00000136117 Nonsense 2700 3096 6 15
ENSDART00000143963 Nonsense 2700 3298 6 20
Genomic Location (Zv9):
Chromosome 4 (position 10492398)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11429025
GRCz11 4 11427874
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGAGACATCGGTGCATATGTGGCCAAAGTATTACCTGGAGGAGCAGCA[G/T]AACAGACGGGGAAGATTGTGGAAGGTAGGCACCTCAATGAAAGGCGGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4334
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3567 4152 16 32
ENSDART00000136117 Nonsense 2701 3096 6 15
ENSDART00000143963 Nonsense 2701 3298 6 20
Genomic Location (Zv9):
Chromosome 4 (position 10492401)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11429028
GRCz11 4 11427877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACATCGGTGCATATGTGGCCAAAGTATTACCTGGAGGAGCAGCAGAA[C/T]AGACGGGGAAGATTGTGGAAGGTAGGCACCTCAATGAAAGGCGGTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3580 4152 17 32
ENSDART00000136117 Nonsense 2714 3096 7 15
ENSDART00000143963 Nonsense 2714 3298 7 20
Genomic Location (Zv9):
Chromosome 4 (position 10496209)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11432836
GRCz11 4 11431685
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTTTATATTTGTATGTGTGTRTTTGCATAGGAATGCAAGTCCTGGAGT[G/A]GAACAACATTTCMTTGAGTGGTAARACGTAMGAGGAGGTGCAAGGGCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5251
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3590 4152 17 32
ENSDART00000136117 Nonsense 2724 3096 7 15
ENSDART00000143963 Nonsense 2724 3298 7 20
Genomic Location (Zv9):
Chromosome 4 (position 10496240)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11432867
GRCz11 4 11431716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAATGCAAGTCCTGGAGTGGAACAACATTTCCTTGAGTGGTAAGACGTA[C/A]GAGGAGGTGCAAGGGCTGGTTGGTCACCAGGTTGGAGAGGCCGAATTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20228
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Essential Splice Site 3696 4152 20 32
ENSDART00000136117 Essential Splice Site 2830 3096 10 15
ENSDART00000143963 Essential Splice Site 2830 3298 10 20
Genomic Location (Zv9):
Chromosome 4 (position 10497178)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11433805
GRCz11 4 11432654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAAACAAAAAAACACGTCTTTCCTTACTGCTGATGTTTTTTGTTTCTT[A/T]GAACTCTGAGGGTACAAAAACTCAGTCCCACCCAGTTTCAGGAGAAATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26248
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092381 Nonsense 3856 4152 25 32
ENSDART00000136117 Nonsense 2979 3096 14 15
ENSDART00000143963 Nonsense 2979 3298 14 20
Genomic Location (Zv9):
Chromosome 4 (position 10501929)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11438556
GRCz11 4 11437405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCCTCTAAAGGAGCAGAGTGAAGGCGAGCATCACCGGCGCTCTCACT[C/A]GGGACAGGGACGTCAGCATTCACCCAAACCCCCTGGAGGACACGGGAGCC
Associated Phenotype:
Not determined