Busch Lab

ZMP

abcb6

Ensembl ID:
ENSDARG00000063297
ZFIN ID:
ZDB-GENE-050517-9
Description:
ATP-binding cassette sub-family B member 6, mitochondrial [Source:RefSeq peptide;Acc:NP_001139165]
Human Orthologue:
ABCB6
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 6 [Source:HGNC Symbol;Acc:47]
Mouse Orthologue:
Abcb6
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1921354]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa45062 Nonsense Mutation detected in F1 DNA Not yet available
sa39536 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19409 Nonsense Available for shipment Available now
sa19410 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45062
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Nonsense 457 851 9 20
Genomic Location (Zv9):
Chromosome 1 (position 5013739)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5452301
GRCz11 1 6150079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACAGAATATGATGGCATTGTGTTATGATATTATCAACAGGTGAAATA[T/G]TACAATGCAGAAAGTTACGAAGTGGGCCGCTTTGAGGACGCCATCCTGAA
Long Flanking Sequence:
TAGGTAAACTTCAAAAATTAAAAATAAGTTTCAGTATTAACATAACAAAAATTTTAATTTCAATAAAAATAGGTAAATATAAATTATAACATGCTTTACAAAAACACATATAACAAAAGGAATCAAAATGAAGTAACATTAAAGTGAAATTCTAGAATTGTCCATTTGTTCACATAGCCAAACTCTACAGTAGAGCTAAAGAAGGAAAGAATGATGCAAATGTAGCAGATCAGCTTTTTATTTATTGACTGCTCTTTTATCCGTGTCTCCGACAGCTCTCACCATCTTTATCACTGAATGGAGAACCAAATACAGGCGTGATATGAACACACAAGATAACAACGCCAAATCCAAAGCTGTGGATTCTTTATTGAACTTTGAGACGGTAGGGCTTCTCTTTGTTTGGTTAAGGTGTAAGAATGTGTGTTACAAATGCAATGTAATGTATAATGCACAGAATATGATGGCATTGTGTTATGATATTATCAACAGGTGAAATA[T/G]TACAATGCAGAAAGTTACGAAGTGGGCCGCTTTGAGGACGCCATCCTGAAATACCAGGTAAAGTGTTTTTAGGTACCAAATTGGTTGTGTTTTATAGTTAATTAGCTTTGTAATGTCTAATACAGGGTGTCTTAAAGTCTTAAATTTCTTGAAATATTGTGTTGTAGGTCATAAATCATTTTTAACAGGTCTTAATTTTTCTATGTCTATGAAAAGTTACCCAATTTGGCCAACACCCAACAATCCATTTCAATAAAACTTTTAACAAATGTTTTATTCATTAATTCTATTTACCCAATATGGTTTAATTATCTTCCGTACTATAAAATGTATAGAAAGTTGTGTTTATAGATACCTGGTAAGGTACACTGACCTTTACAGGCTGTTGTGAGAACGTTTACTTTATTATATTTTTTTAAAACATGTTAAAATTTTGACAAAATGTGTTTATATATACAGTTAGAGTTTGCTTGATTTTACTTGTCTGTAAACAAATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39536
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Essential Splice Site 476 851 9 20
Genomic Location (Zv9):
Chromosome 1 (position 5013797)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5452359
GRCz11 1 6150137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAAGTTACGAAGTGGGCCGCTTTGAGGACGCCATCCTGAAATACCAG[G/A]TAAAGTGTTTTTAGGTACCAAATTGGTTGTGTTTTATAGTTAATTAGCTT
Long Flanking Sequence:
TTCAATAAAAATAGGTAAATATAAATTATAACATGCTTTACAAAAACACATATAACAAAAGGAATCAAAATGAAGTAACATTAAAGTGAAATTCTAGAATTGTCCATTTGTTCACATAGCCAAACTCTACAGTAGAGCTAAAGAAGGAAAGAATGATGCAAATGTAGCAGATCAGCTTTTTATTTATTGACTGCTCTTTTATCCGTGTCTCCGACAGCTCTCACCATCTTTATCACTGAATGGAGAACCAAATACAGGCGTGATATGAACACACAAGATAACAACGCCAAATCCAAAGCTGTGGATTCTTTATTGAACTTTGAGACGGTAGGGCTTCTCTTTGTTTGGTTAAGGTGTAAGAATGTGTGTTACAAATGCAATGTAATGTATAATGCACAGAATATGATGGCATTGTGTTATGATATTATCAACAGGTGAAATATTACAATGCAGAAAGTTACGAAGTGGGCCGCTTTGAGGACGCCATCCTGAAATACCAG[G/A]TAAAGTGTTTTTAGGTACCAAATTGGTTGTGTTTTATAGTTAATTAGCTTTGTAATGTCTAATACAGGGTGTCTTAAAGTCTTAAATTTCTTGAAATATTGTGTTGTAGGTCATAAATCATTTTTAACAGGTCTTAATTTTTCTATGTCTATGAAAAGTTACCCAATTTGGCCAACACCCAACAATCCATTTCAATAAAACTTTTAACAAATGTTTTATTCATTAATTCTATTTACCCAATATGGTTTAATTATCTTCCGTACTATAAAATGTATAGAAAGTTGTGTTTATAGATACCTGGTAAGGTACACTGACCTTTACAGGCTGTTGTGAGAACGTTTACTTTATTATATTTTTTTAAAACATGTTAAAATTTTGACAAAATGTGTTTATATATACAGTTAGAGTTTGCTTGATTTTACTTGTCTGTAAACAAATACAGATGTAGTATCCGTGACGTCACCCATAGGTTTCTAAAGAGCGCAAATGAAGCTACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19409
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Nonsense 755 851 18 20
Genomic Location (Zv9):
Chromosome 1 (position 5020630)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5459192
GRCz11 1 6156970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCATCCTCTACCTGCAGGCCACATCTGCTCTAGACACTCAGACTGAG[C/T]GAAACATTCAGGCCTCGCTGGCTAAAGTCTGCGCCAACAGAACCACAGTT
Long Flanking Sequence:
ATAAGGATGTTGCTAGCATAGTTTAGCATAAATGTCCAAGCTATCATATGTTTAGCCTTAATTTTTGTACATTATACAGCATTTTGCCACTTGCTAGCATGAAGTAGCAGGTTGTTAGCATGAGTCTAGCATGAATCAGCATGTTGATGGTAAAGTCTAGATCTCATTCCGCTGTGGCGACCTCAGATTAATGAAGGGACCTAAGCCGAAAAGAAAATGAATGAATGAATAATTCTCGTTATTCTCATAAACAACAACCCGTGTTGATGGCATGTTTTTAACATGTTATTTTTGACCAATAAAATATAAGTGGGAAAGGCTACCCAACATTATTAGAAAGAAATAGTAAACATGTGAACAGTAAGGGGTTTTCAAGTTCAACAAAATATCAGTCTGGTCTACCACTAATTTTGTCAAAATTTAAAGTACTTTTTTCTTCATAATCTTTTTCCTCCATCCTCTACCTGCAGGCCACATCTGCTCTAGACACTCAGACTGAG[C/T]GAAACATTCAGGCCTCGCTGGCTAAAGTCTGCGCCAACAGAACCACAGTTGTTGTGGCACACAGGTAAACAACAAATGAATTAAGTCATGCTTTCACTAAAACCAGCTTCATTAAAGGTCTTGTAAAGTGCTTTGAAATGTGCATTTCATTATCCAAAAATTTGACTTAATCTCTACTGACACATGAAGAGAGGGCGAGGCATACAGTAGCCCCTCCCCTTTATAAAAAAAACAACAAACCAGCCAATAGTGTTTTGCTAAACTAGTTTTACTTTAGTTTAGCTGTGCCAGGGTGAGTGGTTGTGCTGAAGCGCATCAAATGAAAAGCAAATGAGATTCATCTTTAAGGGGGCGGGGCATACTAGAGAGCATTTGATTGGTCAGACGATTTGATAAGAAACTGAAGTATGTAAATGACGTGATAAAAAATGTTGATCCATTTAGTTGGAAGTGACAAACTACAAGCTTTTGGATGGTTATATCTTCTAAATGTGAATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19410
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Essential Splice Site 776 851 18 20
Genomic Location (Zv9):
Chromosome 1 (position 5020695)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5459257
GRCz11 1 6157035
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCTGGCTAAAGTCTGCGCCAACAGAACCACAGTTGTTGTGGCACACAG[G/A]TAAACAACAAATGAATTAAGTCATGCTTTCACTAAAACCAGCTTCATTAA
Long Flanking Sequence:
TGTACATTATACAGCATTTTGCCACTTGCTAGCATGAAGTAGCAGGTTGTTAGCATGAGTCTAGCATGAATCAGCATGTTGATGGTAAAGTCTAGATCTCATTCCGCTGTGGCGACCTCAGATTAATGAAGGGACCTAAGCCGAAAAGAAAATGAATGAATGAATAATTCTCGTTATTCTCATAAACAACAACCCGTGTTGATGGCATGTTTTTAACATGTTATTTTTGACCAATAAAATATAAGTGGGAAAGGCTACCCAACATTATTAGAAAGAAATAGTAAACATGTGAACAGTAAGGGGTTTTCAAGTTCAACAAAATATCAGTCTGGTCTACCACTAATTTTGTCAAAATTTAAAGTACTTTTTTCTTCATAATCTTTTTCCTCCATCCTCTACCTGCAGGCCACATCTGCTCTAGACACTCAGACTGAGCGAAACATTCAGGCCTCGCTGGCTAAAGTCTGCGCCAACAGAACCACAGTTGTTGTGGCACACAG[G/A]TAAACAACAAATGAATTAAGTCATGCTTTCACTAAAACCAGCTTCATTAAAGGTCTTGTAAAGTGCTTTGAAATGTGCATTTCATTATCCAAAAATTTGACTTAATCTCTACTGACACATGAAGAGAGGGCGAGGCATACAGTAGCCCCTCCCCTTTATAAAAAAAACAACAAACCAGCCAATAGTGTTTTGCTAAACTAGTTTTACTTTAGTTTAGCTGTGCCAGGGTGAGTGGTTGTGCTGAAGCGCATCAAATGAAAAGCAAATGAGATTCATCTTTAAGGGGGCGGGGCATACTAGAGAGCATTTGATTGGTCAGACGATTTGATAAGAAACTGAAGTATGTAAATGACGTGATAAAAAATGTTGATCCATTTAGTTGGAAGTGACAAACTACAAGCTTTTGGATGGTTATATCTTCTAAATGTGAATTTTGTCACTGTTTTGGAACATACTAGCGCAGTGGTTCCCAAAATGGGGGTCGGAACCTCCCAGAGGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7893
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Nonsense 815 851 20 20
ENSDART00000092324 Nonsense 815 851 20 20
Genomic Location (Zv9):
Chromosome 1 (position 5021955)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5460517
GRCz11 1 6158295
KASP Assay ID:
2259-0109.1 (used for ordering genotyping assays)
KASP Sequence:
GTAGGCATGAAGAGCTGCTGGCAAAGGGCGGCCTTTACTCTGACATGTGG[C/T]AGAAACAGCAGCAGGCGCAGGATTCAGACTCAGCTTCTGACTCGGAGACT
Long Flanking Sequence:
GGATGATCTCTGAGTTGCATTGTCCAAAATTAAACGATAAATAGACTTGGGCCAATTGGTGTGTGTGCACCATTGCGCGCAAGGTTTGTATATTCATAACCACCTCAGAGGATATTAAGGGTCATCATGAGTGACTGGCATTGTTAACTAAAGTTTGAGAAACCCTGCACTAGCTTATAGGTATCCTTAAAACGAACACATTTCATGGGACCTTTAATTCTTAGTTTGTTATATAGTGACTTTATTATTGTATGATGCTATCATTGATGTGCATATTGTAGATTGTCAACTATCATCGGAGCTGACGTGATTCTTGTTCTTCGTGATGGCCAGATTGTGGAGAGAGGAAGGTGAGTTGATTTAAAGTGCTAGTATACTTAATCCACAGTCAATCTTGATACGGGTTAATACATGAACTCTGTGGTTTAAAGTCCAGTGCTGTTGTTTGTCGTAGGCATGAAGAGCTGCTGGCAAAGGGCGGCCTTTACTCTGACATGTGG[C/T]AGAAACAGCAGCAGGCGCAGGATTCAGACTCAGCTTCTGACTCGGAGACTAAAGACAGAAAATCGGAGAAACTACAGCCACAGACATCCACTACAGCACACAGGGGACACTAGACATAAGGGAATCGCAATATACGCCGGTATTATGTGCATTTTTAAGCTCAAATAGTGCTGTTTAGGCATGTCCGATTTTTAATTGTTAGATTTTTTTTTGGTTTGCTGCCAGTTTTTAAAGGGATAGTTCACCCAAACTGAAAACTCTTTCATCATTTATTTACACTTCACGTCTCACAAACATGTCTGAGTTTCTTTTCTGTTGAATGCTAATGAAGTTACTTTGAAAAATGTTTGAAACCGGTAACCATTGTCTTCCATTGAATTAGTCTTTTCTACTATGGAAGTCAATGGTTACCGGTTTCTAACATGCTTTAAAATAGCTTTTTTTGTGTTCAACAGAAGAATCAAACATGTTTGAAACCACCTGTGGGTGAATAAATTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18683
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092324 Nonsense 815 851 20 20
ENSDART00000092324 Nonsense 815 851 20 20
Genomic Location (Zv9):
Chromosome 1 (position 5021955)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5460517
GRCz11 1 6158295
KASP Assay ID:
2259-0109.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGGCATGAAGAGCTGCTGGCAAAGGGCGGCCTTTACTCTGACATGTGG[C/T]AGAAACAGCAGCAGGCGCAGGATTCAGACTCAGCTTCTGACTCGGAGACT
Long Flanking Sequence:
GGATGATCTCTGAGTTGCATTGTCCAAAATTAAACGATAAATAGACTTGGGCCAATTGGTGTGTGTGCACCATTGCGCGCAAGGTTTGTATATTCATAACCACCTCAGAGGATATTAAGGGTCATCATGAGTGACTGGCATTGTTAACTAAAGTTTGAGAAACCCTGCACTAGCTTATAGGTATCCTTAAAACGAACACATTTCATGGGACCTTTAATTCTTAGTTTGTTATATAGTGACTTTATTATTGTATGATGCTATCATTGATGTGCATATTGTAGATTGTCAACTATCATCGGAGCTGACGTGATTCTTGTTCTTCGTGATGGCCAGATTGTGGAGAGAGGAAGGTGAGTTGATTTAAAGTGCTAGTATACTTAATCCACAGTCAATCTTGATACGGGTTAATACATGAACTCTGTGGTTTAAAGTCCAGTGCTGTTGTTTGTCGTAGGCATGAAGAGCTGCTGGCAAAGGGCGGCCTTTACTCTGACATGTGG[C/T]AGAAACAGCAGCAGGCGCAGGATTCAGACTCAGCTTCTGACTCGGAGACTAAAGACAGAAAATCGGAGAAACTACAGCCACAGACATCCACTACAGCACACAGGGGACACTAGACATAAGGGAATCGCAATATACGCCGGTATTATGTGCATTTTTAAGCTCAAATAGTGCTGTTTAGGCATGTCCGATTTTTAATTGTTAGATTTTTTTTTGGTTTGCTGCCAGTTTTTAAAGGGATAGTTCACCCAAACTGAAAACTCTTTCATCATTTATTTACACTTCACGTCTCACAAACATGTCTGAGTTTCTTTTCTGTTGAATGCTAATGAAGTTACTTTGAAAAATGTTTGAAACCGGTAACCATTGTCTTCCATTGAATTAGTCTTTTCTACTATGGAAGTCAATGGTTACCGGTTTCTAACATGCTTTAAAATAGCTTTTTTTGTGTTCAACAGAAGAATCAAACATGTTTGAAACCACCTGTGGGTGAATAAATTGTC
Associated Phenotype:
Not determined