Busch Lab

ZMP

NP_001107902.1

Ensembl ID:
ENSDARG00000063288
Description:
solute carrier family 2 (facilitated glucose transporter), member 11b [Source:RefSeq peptide;Acc:NP
Human Orthologues:
AP000350.10, SLC2A11, SLC2A5, SLC2A7, SLC2A9
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 11 [Source:HGNC Symbol;Acc:14239]
solute carrier family 2 (facilitated glucose transporter), member 7 [Source:HGNC Symbol;Acc:13445]
solute carrier family 2 (facilitated glucose transporter), member 9 [Source:HGNC Symbol;Acc:13446]
solute carrier family 2 (facilitated glucose/fructose transporter), member 5 [Source:HGNC Symbol;Acc
Mouse Orthologues:
Slc2a5, Slc2a7, Slc2a9
Mouse Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 9 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1577 Nonsense Available for shipment Available now
sa13882 Nonsense Available for shipment Available now
sa13746 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1577
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092333 Nonsense 66 504 3 12
ENSDART00000132262 None None 314 None 7

The following transcripts of ENSDARG00000063288 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 10927739)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9515499
GRCz11 5 10020137
KASP Assay ID:
554-1520.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTCTCAGGCTGTGCAGAACTTTATTAATCAGACCTGGACGGAGCGCTA[C/A]AGCACTGAAATCTCCAGTGATATGTTAACCCTCCTCTGGTCCATCATCGT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control; 5 dpf
Control; 5 dpf
Mutant; 5 dpf
Mutant; 5 dpf
Control; 5 dpf
Control; 5 dpf
Mutant; 5 dpf
Mutant; 5 dpf
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
iridophore
ZFA:0009199
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
xanthophore
ZFA:0009198
absent
PATO:0000462
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa13882
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092333 Nonsense 128 504 4 12
ENSDART00000132262 None None 314 None 7

The following transcripts of ENSDARG00000063288 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 10928172)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9515932
GRCz11 5 10020570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAACAAMACCTTTGCTCTGTTGGCTGCTTTGTTCATGGGTTTRAGTTA[T/A]CCTGCAAGCACTTTTGAGCTTTTAGTCATTGGAYGCTTCMTGACAGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13746
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092333 Nonsense 227 504 6 12
ENSDART00000132262 Nonsense 37 314 1 7

The following transcripts of ENSDARG00000063288 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 10935154)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9522914
GRCz11 5 10027552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCGTCCTGCAGCTTCTGACKCTGCCCTGGTTCCCGGAGAGYCCTCGATA[C/A]CTGCTCATCGACCGAGGGGACGACATCGCCTGCCAGAAGGGTACAAACAC
Associated Phenotype:
Not determined