Busch Lab

ZMP

btbd11a

Ensembl ID:
ENSDARG00000063255
ZFIN ID:
ZDB-GENE-050419-142
Description:
Ankyrin repeat and BTB/POZ domain-containing protein BTBD11-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LVW
Human Orthologue:
BTBD11
Human Description:
BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:23844]
Mouse Orthologue:
Btbd11
Mouse Description:
BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1921257]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40246 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1228 Nonsense Available for shipment Available now
sa31385 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40246
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Essential Splice Site 340 1021 2 17
ENSDART00000141944 Essential Splice Site 51 732 1 16
Genomic Location (Zv9):
Chromosome 4 (position 10940376)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11877003
GRCz11 4 11875852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGAACAGTCACTTCTGGCGACCCGTGTGGGGAGCATCGCCGAGCTCAG[T/G]AAGTACTCATGCCTTAAAAATGAGTTAGTAGGTTATAGTTATGTCATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1228
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Nonsense 380 1021 3 17
ENSDART00000141944 Nonsense 91 732 2 16
Genomic Location (Zv9):
Chromosome 4 (position 10913708)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11850335
GRCz11 4 11849184
KASP Assay ID:
554-1137.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCACCAGAACCGCACGGGCTCCGTTCACTGGGAGCCCGAGGCCCTCTA[T/A]ACGCTCTGCTACTTCATGCACTGTCCGCAGATGGAGTGGGAAAACCCTAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26249
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Essential Splice Site 460 1021 5 17
ENSDART00000141944 Essential Splice Site 171 732 4 16
Genomic Location (Zv9):
Chromosome 4 (position 10904689)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11841316
GRCz11 4 11840165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGTAAGCACTGTTCATAATGTTTGGACTGATATTTCCTTTATTCCAC[A/T]GAGCAGACGACTGTTTCTGTGCCACACGGAAACTGGACGCTGCGTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31385
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092250 Essential Splice Site 888 1021 15 17
ENSDART00000141944 Essential Splice Site 599 732 14 16
Genomic Location (Zv9):
Chromosome 4 (position 10883352)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11819979
GRCz11 4 11818828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTCCTCAAATGTTTCTTGGAAGTCTGAGAACATCTCATTGTTTTTTTC[A/G]GCTGGTAATGCAGTACCTCTACTGTGGCGGCACTGAGTCACTGCACATCA
Associated Phenotype:
Not determined