Busch Lab

ZMP

xpo1

Ensembl ID:
ENSDARG00000063229
ZFIN ID:
ZDB-GENE-070530-6
Human Orthologue:
XPO1
Human Description:
exportin 1 (CRM1 homolog, yeast) [Source:HGNC Symbol;Acc:12825]
Mouse Orthologue:
Xpo1
Mouse Description:
exportin 1, CRM1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2144013]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10716 Nonsense Available for shipment Available now
sa7435 Missense Mutation detected in F1 DNA Not yet available
sa42931 Nonsense Mutation detected in F1 DNA Not yet available
sa7436 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28854
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Nonsense 55 1074 2 24
Genomic Location (Zv9):
Chromosome 17 (position 23798562)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23952004
GRCz11 17 23970405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTGTTTCAGCAAAGAATGGCCCAGGAGGTGCTGACTCATTTGAAG[G/T]AGCACCCAGATGCGTGGACACGAGTCGACACCATTCTAGAGTTCTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Nonsense 78 1074 3 24
Genomic Location (Zv9):
Chromosome 17 (position 23801485)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23954927
GRCz11 17 23973328
KASP Assay ID:
2261-1044.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGCTYGGGTCATTAATGCTTGATTTGYTCTCTTGGCATTACAGYACTA[T/A]GCTCTGCAGATTCTGGAAACAGTTATTAAAACAAGATGGAAGATTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7435
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Missense 459 1074 12 24
Genomic Location (Zv9):
Chromosome 17 (position 23804256)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23957698
GRCz11 17 23976099
KASP Assay ID:
554-4130.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTCGAGAATTCAKGAAGGATACAGACTCCATTAATCTATACAAGAACA[T/G]GAGGGAGACACTTGGTGAGAACTTAGTCATTCTTCACTTTTAATGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42931
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Nonsense 508 1074 13 24
Genomic Location (Zv9):
Chromosome 17 (position 23804507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23957949
GRCz11 17 23976350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCCTGGAAGAACCTAAACACACTGTGCTGGGCCATTGGTTCCATTAGT[G/T]GAGCCATGCATGAGGAAGATGAGAAGCGGTTCCTCGTCACAGTCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7436
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092188 Missense 642 1074 16 24
Genomic Location (Zv9):
Chromosome 17 (position 23805823)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23959265
GRCz11 17 23977666
KASP Assay ID:
554-4131.1 (used for ordering genotyping assays)
KASP Sequence:
CACCATTTCCTGTTTTCAGGTGCACACGTTTTACGAAGCTGTTGGGTATA[T/G]GATTGGAGCGCAGACCGACCAGGCTGTGCAGGAACACCTGATAGAGAAGT
Associated Phenotype:
Not determined