Busch Lab

ZMP

DOCK3

Ensembl ID:
ENSDARG00000063180
Description:
dedicator of cytokinesis 3 [Source:HGNC Symbol;Acc:2989]
Human Orthologue:
DOCK3
Human Description:
dedicator of cytokinesis 3 [Source:HGNC Symbol;Acc:2989]
Mouse Orthologue:
Dock3
Mouse Description:
dedicator of cyto-kinesis 3 Gene [Source:MGI Symbol;Acc:MGI:2429763]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa18344 Essential Splice Site Available for shipment Available now
sa24207 Nonsense Mutation detected in F1 DNA Not yet available
sa24208 Nonsense Available for shipment Available now
sa1627 Essential Splice Site Available for shipment Available now
sa37557 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9819 Essential Splice Site Available for shipment Available now
sa37558 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18344
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 497 1938 13 57
Genomic Location (Zv9):
Chromosome 22 (position 34948130)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32187827
GRCz11 22 32142451
KASP Assay ID:
2261-7023.1 (used for ordering genotyping assays)
KASP Sequence:
AACCCTCTGGATAWCAACRCAACTCTCTTCCACCAAACTAACACAGAATG[G/A]TAACATACTAAAGCCAYGTTCACATGTACACTGRTATTTTAYAAATKACN
Long Flanking Sequence:
TGCTAACTAAATAAATTATAGTGTTTTAGTTCATTTTGTGTTGTTTTTAGTTGTAACATTATACAATAAGGTTGTATTAATTAATGTAATCTTTGCTCATTTTAGATCATGAAAATAAAGTTAACTCCGGCACATTAATGCTAACAAGCACGAAGTTGGATTTTAGTAACACATTAGTAAATGTCGAGCTATGATTGATAACATAACCTAATGAAACCTCAATGAAAAGTGTGACCTTTGTTAATCTTGTTAATGACAATAACAAAGATACAGGGCATTGCACGTTCAAATGACCTTTAAAATTGTCTTGTGTATGTGTGTTGATCAGTGTGATGAAAACACCACCTTCAGTAACCACGCGCTGTACCTGGGCCTGCCCTGCTGTAAAGATGACTTCAACGGCTGCCCGAACATCCCGTCCAGCCTCATATTCCAGCGCAGCACGAAGGAAACCCTCTGGATATCAACACAACTCTCTTCCACCAAACTAACACAGAATG[G/A]TAACATACTAAAGCCACGTTCACATGTACACTGGTATTTTATAAATTACTTTTTCTCGTCTTCGTTTTTAACAATATTAAATTAATTAAATTTGATGATTACAATTCAGTTCAGTTCATCTTTGATTCTATAGCGCTTTAAGTTGTGTCAAAGCAGCTTCACATAGACGATTGTAGTCAATTGAAACAGTGTCAGTCCAGTTTTCAGTGTTTAAGTTCAGTTTGGTTCAGTTTAGTTCAGTTCAGCTTATCATCCACGGCTGATAGTCCAAACACTGAAGAGCAAATCCATCCATGCGCAGCTCCACAAGTCCCAAACTATGCAAGACAGTGGTGACAGTGGCGAGGAAAAAACTTCACTAATTGGCAAAAGTGAAGGATAAAAAACCTTGAGAGAAACCAGGCTTAGTTGGGCACAACTATTTCTCCTATGGCCAAACGTCTTGTGCAGAGCTCTAAGCGCTGGAGGCTGGAGAACGCCGGACGTCAGTGAAAACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 841 1938 24 57
Genomic Location (Zv9):
Chromosome 22 (position 34975471)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32215168
GRCz11 22 32169792
KASP Assay ID:
2261-7024.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTAAATTCACTAAGAATATACTGTAATAACATTACATGTTTGCAAACA[C/T]AACTCATTTTGTTTATAAAGTGTCTAGGGACTCCACTGACCCAAGGTTTG
Long Flanking Sequence:
ATGTCTTCGTGTGGGTGAACTTCATGAAAACTGCGAATAAAGTACATATTTTAAGAACACAATAAAAAAGATTGGACCATTACATTTATTTTGTTTTTTGGTTCAACTTTCTTTATGTAAAATTTAAATACATAGTTGTTTTTGCGTAAAATAAGGCCGTGATGTTTCTTGTCAGGCTTCATGAGACTCACCCGCGCATGCTTGTCTTATTCTTGTTTTTTTGTCTCCTGCATTTAGTTTGTTTTAACACCTGCTGGGAAAACTCAACAGTAACTATCTAAAACACATGCATACTCAGATCTACACATTTGATGTCTTCTTACACATTTATTTTGTTTTCAATGTTATTTGTGGATGTATTTAGGATAGATCTCTTTCAAACAAAACCCAGCAGAAACTAGTCATGTTTATGTGTCTGTTTAGTTAAAAGAAGCAAGGAAAGTCCAGATGGGGTAAATTCACTAAGAATATACTGTAATAACATTACATGTTTGCAAACA[C/T]AACTCATTTTGTTTATAAAGTGTCTAGGGACTCCACTGACCCAAGGTTTGCAATAGTGCGAGTAGATCGTGAGTATATTGCAGTGTGTAATATACATTCAGTATATTTTGTTACAAAAAGTAAAAAAAATACTTTATTTGGGTTATTTTGGGATTTGTTTTGCTCTTGTGCCATTGTAATTTAATTATTGTGATCCATCCATAATAGATATGTGCACGTGATGTAGCTATGCACTAGTTTTATATAAGTTTATATTGGTTACGTGATGGACATTGCGCTCTTTGCTCTCATTAACATGCTTAAATACCTGTGCTATATGACAATACTAAAACTGTTTAGGTCCTCGTGTATGTGATTTAAAATTTGGGACTCTACTGAAGTCTGTTCTGAAATGAAAGTGTCAGACTTGACATCATTCGCTAGGGTTTTTAATGCCGCGCGACTCGCATTGCTAGGTGAAAACTACCTGCTTACACTGCAGACACGAGAACACAGATCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29825
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1080 1938 31 57
Genomic Location (Zv9):
Chromosome 22 (position 34995270)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32234967
GRCz11 22 32189591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTGAGGGCAAAGGAGACGAGAATTACAGAGAGCTCTTCAGTTTGCTG[T/G]AAGTAAACACACACACACACACACACACACACACACACATGGGAATTGGT
Long Flanking Sequence:
AGATAGATAGATAGATAGAAGGAAAGACGGACGGAGGAATGGATGGATGGATGGAAGGATAGAGGGATAGACAGACTGACTGACAGACAGACGGACGGACAGACAAATAGATAGATAGATAGAAGGACAGACAGACGGACAGATGGATTGATGGAAGGATAGACTGACTGACAGACTGACGGATGGACGGACGGATGGACGGACAGACGGACGGACGGACAGACAGACAGATAGATAGATAGAAGGATGGACAGACAGACAGACAGACAGATAGATAGATGATGAAATGATAGGCTATGATAGATAGATAGAATGTGATGAAAAATAAATAAAAATTAACATAATTTATATATACTTATGAATAAGTATATACTGTTTAATTACATGTGAATGAACTGATGCTTATGGTGCAGGTGGAGGCGGAACTGATAGACAAACTGGACAGTCTGGTGTCTGAGGGCAAAGGAGACGAGAATTACAGAGAGCTCTTCAGTTTGCTG[T/G]AAGTAAACACACACACACACACACACACACACACACACATGGGAATTGGTGGTTTACGAGGACTCTTTATAGGCATCATGTATAAACAATAATTTTATGACCTTACCGCAAAACCCAACCTTTACAGGAAGCATGTGTGCAAACTTTGAATGTCAAAAGACCTTGTTATTTATGATTTTGAAGCATTTTGAATTATGAGGACACACTGCATGTCCTCATTAACCCCTTCAACATTGTAATACCTGGGTCATACTCATGTCATAATACAAACGTGTCCTCATAAAGCACATAAACAAGCACACCCAAACACAGATTGAGTGCTTTTGCTATAACCCGAGTGTCTCTGATTTTGCCTTGTGCTGCGGGATTATTAGAACTCAGCTGTTTGGGCCGTACCCCAGGTAAGAGGAAACCCACTCTTTTCAGGCCAGTCAGAAGCCACTCAAAATGATCTTCCATTACAAATCCCTCTATTTCCTCTGTGAAGTGTCCTTAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24208
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 1146 1938 35 57
Genomic Location (Zv9):
Chromosome 22 (position 34998359)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32238056
GRCz11 22 32192680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGACCTGAGAGTCACATGATCTGGACGTTTACAGAATTTCTACAAGT[C/A]GGAGATCAATAAGGAGGAGATGTACATCCGATACATTCATAAGCTGTGTG
Long Flanking Sequence:
CCTACGTCAAGCAAATTGTGCTGAAATCAGGAAAAGATATGCGTAATCTGAATTAATTGTGCAGTATTTAAACCTTAAATTGAATGCTTGGTCAATAAATATTTGGATGTTTAGTAACCCTGGCCCACACATCTTAAATAGATGGATGTATCACTGCAGCAAGAGCATACAACGTTCCTGTTCAGTCTATCATATGTAATCTAAAAGCAAACAGTAGAAATCTCTTTATAAGTTGCATAGAAAGCAGCCAATCAGATTCAGACTTCATATTGTGCATATATATGATCATTGGGCGTGGCATCTGTAACTACTGAGACGTCCTGTTTCTGTTGTTGGCAGAGATTGCATGAAAGGTGATGAGACGGAAAACAAGAAGATCGGTTGCACGGTCAACCTGCTGGTGAGTTTGAGCTTTCATAATAAACATGACGCAGCTTTGTGAGCAAGCTGAACTGACCTGAGAGTCACATGATCTGGACGTTTACAGAATTTCTACAAGT[C/A]GGAGATCAATAAGGAGGAGATGTACATCCGATACATTCATAAGCTGTGTGACATGCACCTGCAGGCGGAAAACTACACAGGTGAGACACTTCATCTTACTGCAGGGGTGTCCAAACTCGATCTTGAAGGCCCGGTGTCCTGCAGATTTTAGCTCCAAGGGTCCGTTCTTCGTACCTCACTTAAATGATCTAAGATGATTTGGCAGATTCTGGATCTTTTGATCTTGATAACTGATCTCTCGCTAATATGGTTCTTCAAACAAGTTCGCGAATCAGATTAGAATGTCTGGATGAACTGATCTGAGATCGCTGCGTGTGTTGTGAAGGACAGATCTATCGATCCTCGAAATCATGATCAGCAATGCAACGATTGGCTGACGGCACAGCAGCGTAATGACATCATCTGATTAATATTCAATTATCCATGTGAGCAAAATTACATCAAATTAGCAGTAAACGGTTTGTTAAATATGACACGCAATAACCTTCCACATTTGTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5009
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 1232 1938 37 57
Genomic Location (Zv9):
Chromosome 22 (position 35007283)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32246980
GRCz11 22 32201604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTTCTCTTGTTCTCTTCTCAGTGTTGGGAGTATGGCATCCCGCTGTGC[C/T]GAGAACTAGCCTTTCAGTACGAGTCCCTGTACGATTATCAGAGTCTCAGC
Long Flanking Sequence:
AGCTCTGAACAGGAAGTTTGACCAGAGGAGAAATGGTCATGCCCAACTAAGCCTGGTTTCTCTCCTTCACATTGGTCTGTTGGTGAAGTTTGTTCCTCCACTGTCTCCACTGTCCTGCAATGTTTGGGCCTTGGGGAGCTGCACATCTTCAGTGTTTCAACTTTCAGCAGTGAAGATCTGAACTTCAGCTCTGAACACTGGACTGACACAGCTTCAGTTTACTAGATCGTCTGTGTTCAGCTGCTGCCACACAATCTACATTGGAAAAGCGCTGGAGAAATAAATATGAATGGGATTGAATTTAAAGGGTGAAACATGCTGCCATGTGATTGGCTGATTGGAGGTTTTACACTAAAGAGCAGTTTAACACGTCTACCTAATAATGTGGCTGGTCAGTCTACTTAACGATCAGGATCTTTCTTATTTTATAAATTGCACATGAAACCAGCAGTCTTCTCTTGTTCTCTTCTCAGTGTTGGGAGTATGGCATCCCGCTGTGC[C/T]GAGAACTAGCCTTTCAGTACGAGTCCCTGTACGATTATCAGAGTCTCAGCTGGATACGGGTCAGTGCCTTTTGATGTTCTTTTTAGAAAACGTGCATATATGAATAGCGATTATATAACAGCACTTTGAGTGGACGTCGCAGCTATTAATGTACTGTTATGTATTATGCTCAGAAGGAGGTCAGCGCTGTGTGAATATTCAGCTTTTTCTTTCTGCACAGAAAATGGAGGCGGCATATTATGACAACATCATGGAGCAGCAGCGACTGGAGCCCGAGTTCTTCAGGGTGGGGTTTTATGGGCGGAAGTTCCCTTTTTTCCTCAGGGTGAGACTTTACTTCTATATGCTCTATTTCTTTGTACGAATAATAATTAACTTTATGTAAAACATGTGTTGTATATTTTTTTTTTTTTTCTCTCAGAATAAGGAGTTTGTTTGTCGGGGTCATGACTATGAAAGGCTTGAAGCCTTTCAGCAAAGAATGCTGGGGGAATTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1627
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1389 1938 40 57
Genomic Location (Zv9):
Chromosome 22 (position 35009609)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32249306
GRCz11 22 32203930
KASP Assay ID:
554-1568.1 (used for ordering genotyping assays)
KASP Sequence:
ATGACCGACCATTCCACAAGGGTCCTAAAGACCGGGAGAATGAGTTCAAG[G/A]TAAAATTATGCCTCTCTTCACTTSTGGATTATGATGAACCGCATGTTACT
Long Flanking Sequence:
TATTTATGCATTAGTTTATTTTATTATGATGTGCACTCCTTATTTTTTAGCAAAAATATTTTTTTAAAGATGTATGTTTGACGTGTTTGCCTTCATTGACAGGACAGTATATAAACAGGAAGTGAAGGTGGAGAGAGCAAGGGAGGAAGGATTATAGAAAGGTCCACATGCCAAGATTTAAATGTGGGATGCCTGAAGCGCAGTTGGTGCAATCAGTGCAGACAATGACATAAACTCTTGACAGCATTCTTATTTCCAGTTTGATTTATTCGCCTATACTACAAGTTGAAAAAAAACAGTAGCGGTGTTTTGCCTTGACATAAGCTTTGCTAGACCTCCAGATCTACGCCGTGTCTGCAGTTCCTGAAAACATGGACGTTCTTCAGATGGACCGCGTGCCCGACCGCATCAAGAGCTTTTACAGAGTCAACAACGTCCGACGATTCAGATATGACCGACCATTCCACAAGGGTCCTAAAGACCGGGAGAATGAGTTCAAG[G/A]TAAAATTATGCCTCTCTTCACTTCTGGATTATGATGAACCGCATGTTACTTAAAGTGTTGTTGTGTTTTCAGAGTCTATGGATCGAGCGAACCACACTAATCCTCACCCACCCTCTGCCCGGCATATCCCGCTGGTTTGAAGTGGACAAGCGAGAGCTGGTGGGTTAATCTGCATAATCTTTAATGTGATCAGCTCGTTTACATGAATATTCTTAACCTGTTTGTGCTTAAAGTGATAATTCACCCTTAATTATAATAATCATTACTGAATTATGCACTACTTATACTTATTTTTAGCCCTTTTCATTTCCCTTTTTTTATATGTTACTCTAAATTACAAGGGAACATTCATCCATATTTTGACATTTGATAAAGGTGATTTAAAACATTAAAGAAGATACTTTACTTGTATTTGATATGCTTTCTATGTATGTAAACTCGAATGGGAAAATACTGCAGTAATCCATAGTAAATATTTTTTAAATCATACTATAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37557
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1698 1938 51 57
Genomic Location (Zv9):
Chromosome 22 (position 35020839)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32260536
GRCz11 22 32215160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGATCGGCCCAGTAGTGCCATGTACCCCAATATAACTGAGAATGGACAG[G/A]TGGTGTGTTTACCTTTCAAACAATTAATTTAGTTTAAAATTCATCAAACT
Long Flanking Sequence:
TTGCCCTCAAACTAAGAACGAAAAATAATTTTGAAGAACTTTGAAGTATACCAGGGCCTTAAACCAAAGAAACCACTCACAACCCTCGCAACTCCCTGACAACCCTTCAAAACAGCTTAGCTTCTGCAGAACAACACCATTAGCCAGGATCAACACTACGAACTAACAAAAACACTGAAGATGATCTTTTCTGTTTTCCCCATGTAACCTTTCAGCCCAGTCCATCGTCATCCAGCTTGAGTTCGACGCATTCAGCTCCGTCTCAGATGATCAACTCAGGGCACGGCAGCATCAGAGGTAAACACCAATAACGTTTTCATATTAACATCAGGATTAACGTTCACGATTCCCAAATTGAGATTACTTTTAAACTATTTCCAGTTGGATCCCCATCACTACCTGACAGATACAGACACAATCGGGAGATGTTGATGCTTCTGCCACCGCACAGGGATCGGCCCAGTAGTGCCATGTACCCCAATATAACTGAGAATGGACAG[G/A]TGGTGTGTTTACCTTTCAAACAATTAATTTAGTTTAAAATTCATCAAACTATCTGGAACTAAGTTTTGAAGGTGAGATGATGTCAGCAATAAATGTTTATTTCCCTTTTTTTCACCAGCCTACTAATCATCAGAGGGCTCTGTATCATCAAGTCATTGGTCCCTGCAAACCTTGCAGTGACCCCAATCTTTCGGTGGCTGATAAAGGTATGACTGGGTGTGTATAATTCTCTGAACCCACTGTAACTCACAATCTCCTGATTGTGCAGAATTACAATCCATGCTCTATCTGAAATCCCCCCCAACTCTGAATGATTTTTTGAATATGCAACAATTCTGGCGTAATATCCTGACCATGTAAATCTGATATGTTTGTTGGTGAACAGCGTGCTTAAGTTGGTCACCCTCCTGTACCAGCTACAAAACATCCTCTCTTGTTAGGCTAGTTTAGCAGCCGGCTGGTAACAAACCTTTGATCAGACCTACCTGAGATATCTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9819
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1771 1938 55 57
Genomic Location (Zv9):
Chromosome 22 (position 35023923)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32263620
GRCz11 22 32218244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCATGTCCGCGMTAGCATTCCACGATGTCTAATGTCCTGTTAACCTCA[G/T]ATGTCCCCACCTGTTCTCCAGCCAAAACACCCAGAGCCGAATTGTCCGCC
Long Flanking Sequence:
TAGTCTTTTAATTTTGATTATTATAATAATATGCATCCTGTCAACTACCCGAATGTGTCTAAAAAGTAGCCTCCTCCTTTTCATTTCAGTAGATTTCCCTACATCTAAAACATCAATCCTTTGCTGTTAGCATAAATCCTCACATGATTGAGTAATTTCCTGGTCATTCCCTCTATCCCAGCCATTACCCTCCTCTGAACGTCAGCTAAGTTCAGAAAGAGTCCTTGATAGTGCTTGCTGAGTGAGCGCATGCCGACCTGTGTGCGGGCAAGTATATACCGGCGTGTGCTCTTTCCAACCCTGGTTGTCCAACTGTGTCTCCCCCTTTAGGACACTTCTCGATGCACTTTGATGCTTTCCACCACCAGATCAACGAACTCCCTCCAGCTCTCCCCGCGCGCTCCTTAAGAAAGGTATCCTCCGCCTAGATGTGTCCTGTTAGTGCTCATCATGCATGTCCGCGCTAGCATTCCACGATGTCTAATGTCCTGTTAACCTCA[G/T]ATGTCCCCACCTGTTCTCCAGCCAAAACACCCAGAGCCGAATTGTCCGCCAGTCTGCTTTTGGTTATAATTGGGTTGTTCTTGTCCCTAAGATGCTGAAAGTGTTTGGGTTCATTATGTAATTGTTTCATGTGCATCTGTATATGTGCGCATCTATAGAGCAATTTGTGTGTATGTGTGTGCATATGTGTGCTTGAGATTGTCGCTTCTCCATTATGAACTGGAGATCAGTAGGATGCAAGTGAAGGATGATGACTATAGGGTGACTGATAAAGTCAAATCTGCTTCCGTCATCCAGAGACCTAAACTTCAGGTCAGAGAGTAGCTTTAAATCAGAAGTGCTGAAGCCTGCTCCTGAAAAACAACTTGCTATTTTGATTGATATACCAGAAGTAGCCATAGAATTAAATTGGGTTTGTTTGGCAGTGTTTGCTTTAAATTTACTGCTTATGATGGGAAAGTCCTTGTGCCCAAGTGATAGGACAAACATTCTGTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37558
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Essential Splice Site 1791 1938 55 57
Genomic Location (Zv9):
Chromosome 22 (position 35023987)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32263684
GRCz11 22 32218308
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCCAGCCAAAACACCCAGAGCCGAATTGTCCGCCAGTCTGCTTTTGG[T/C]TATAATTGGGTTGTTCTTGTCCCTAAGATGCTGAAAGTGTTTGGGTTCAT
Long Flanking Sequence:
AGTAGCCTCCTCCTTTTCATTTCAGTAGATTTCCCTACATCTAAAACATCAATCCTTTGCTGTTAGCATAAATCCTCACATGATTGAGTAATTTCCTGGTCATTCCCTCTATCCCAGCCATTACCCTCCTCTGAACGTCAGCTAAGTTCAGAAAGAGTCCTTGATAGTGCTTGCTGAGTGAGCGCATGCCGACCTGTGTGCGGGCAAGTATATACCGGCGTGTGCTCTTTCCAACCCTGGTTGTCCAACTGTGTCTCCCCCTTTAGGACACTTCTCGATGCACTTTGATGCTTTCCACCACCAGATCAACGAACTCCCTCCAGCTCTCCCCGCGCGCTCCTTAAGAAAGGTATCCTCCGCCTAGATGTGTCCTGTTAGTGCTCATCATGCATGTCCGCGCTAGCATTCCACGATGTCTAATGTCCTGTTAACCTCAGATGTCCCCACCTGTTCTCCAGCCAAAACACCCAGAGCCGAATTGTCCGCCAGTCTGCTTTTGG[T/C]TATAATTGGGTTGTTCTTGTCCCTAAGATGCTGAAAGTGTTTGGGTTCATTATGTAATTGTTTCATGTGCATCTGTATATGTGCGCATCTATAGAGCAATTTGTGTGTATGTGTGTGCATATGTGTGCTTGAGATTGTCGCTTCTCCATTATGAACTGGAGATCAGTAGGATGCAAGTGAAGGATGATGACTATAGGGTGACTGATAAAGTCAAATCTGCTTCCGTCATCCAGAGACCTAAACTTCAGGTCAGAGAGTAGCTTTAAATCAGAAGTGCTGAAGCCTGCTCCTGAAAAACAACTTGCTATTTTGATTGATATACCAGAAGTAGCCATAGAATTAAATTGGGTTTGTTTGGCAGTGTTTGCTTTAAATTTACTGCTTATGATGGGAAAGTCCTTGTGCCCAAGTGATAGGACAAACATTCTGTTAAAAAAGGGCATACTTCAAATTAAAGCTACATTAAAGCAATACTCTAATTTTAATTAAAAAATAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13650
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092090 Nonsense 1870 1938 56 57
Genomic Location (Zv9):
Chromosome 22 (position 35025722)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32265419
GRCz11 22 32220043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGACCACAGACACGGAAGAGGCAGAAAGTCCCTATCTCCCCGTACGCTA[C/A]AGCGTCTCCGAGCCTGAAGTTCTGGACCCTCTCAAGCCMGCTCCATGCCG
Long Flanking Sequence:
TAAATTATGGAACTATGGGGCCATTTTAATTTTAAATGAACTATTTCTTTAACAATATTTCCACTGTCAAATGTGGAGATCATTAGAACTTAATGTGGTTAAAACTTCAACCTGTAGGATGGAAGTTCTCCAGGAGTTGGATTTAGCTGCCTTGCTCTTAGATCACCTGAATGTCATCCTACTGGTCTTACATTTGAACGTTGCATTTAAAAAAGGTGTTAATAATGCAGTGTAATGTTGACCTTGTTTACCTTTCCTTACCAGTCGCCCCTGCACCCTATACCTGCCTCACCCACCAGTCCACAGTCGGGGCTGGATGGCAGTAACTCCACCTTATCCGGCAGCGCCAGCAGTGGTGTCTCCTCCTTGAGTGAGAGCAACTTCGCCCAGTCCTCCTCTGAGCCTCCAGCTCGAGCCGACACCTTGGACTCGATGCCGAGCAGCCAGGCCTGGACCACAGACACGGAAGAGGCAGAAAGTCCCTATCTCCCCGTACGCTA[C/A]AGCGTCTCCGAGCCTGAAGTTCTGGACCCTCTCAAGCCCGCTCCATGCCGTAGTCACTCAGCCCCGTTGGGTGTAACCCCAGGGATACCCTCTGATGGCCACCACCACCATCACCTCCATCTCCACCATCACCACCCACACGCAGTGCACATCACCCACCCTCACTACCACCACCACGAGCCTGCACCCGCACTGCCTCCCAAACCTTACCTGAGGGAAGGGTGCATCCCTGAAGAGGACCTGAGGCCAGTTCCGAGGCCTATGCCACGCAAGATCTCCCAGCCTTTGCTTACTACCAAGGAGGAACAGGCCAAGGTGGCCTGGGAACATGGCATTAGTGAAGAATAGACGAAGAATAACCTGGACTGTAAGCTTTGGCATGATTTGTGGCAGGATTTTGGGAAAGTCCCCAAAAATTATTCATTTGAACCTTCTCTGCTCCCAGTATACCCAGTGTAGGTCTTTTCAACCTTTTAAGAAGTGCTTGCCATGTTACAGAG
Associated Phenotype:
Not determined