Busch Lab

ZMP

LOC571043

Ensembl ID:
ENSDARG00000063158
Human Orthologue:
SLC24A2
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 [Source:HGNC Symbol;Acc:1097
Mouse Orthologue:
Slc24a2
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34258 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34258
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092051 Nonsense 127 588 1 15
Genomic Location (Zv9):
Chromosome 7 (position 76339723)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 73115618
GRCz11 7 73337731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTTCTTCGTCCCAGCGCTCACGGTGATCACGGAAAAACTTACGATTT[C/A]GGACGATGTGGCGGGTGCTACCTTCATGGCGGCTGGAGGATCGGCTCCTG
Associated Phenotype:
Not determined