Busch Lab

ZMP

nrxn2b

Ensembl ID:
ENSDARG00000063150
ZFIN ID:
ZDB-GENE-070206-7
Description:
Neurexin 2b beta [Source:UniProtKB/TrEMBL;Acc:A1XQX7]
Human Orthologue:
NRXN2
Human Description:
neurexin 2 [Source:HGNC Symbol;Acc:8009]
Mouse Orthologue:
Nrxn2
Mouse Description:
neurexin II Gene [Source:MGI Symbol;Acc:MGI:1096362]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20840 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26861
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091955 Nonsense 377 681 6 7
Genomic Location (Zv9):
Chromosome 7 (position 616877)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 463342
GRCz11 7 605038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTCGCTCTGCAGAATACTGACGATCTGTTAGTAGCATCTGCT[G/T]AATGTCCGAGTGATGATGAAGATCTCGAGGAGTGTGAGCCTGGAAACGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20840
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091955 Nonsense 498 681 7 7
Genomic Location (Zv9):
Chromosome 7 (position 634443)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 480908
GRCz11 7 622604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTCACTGACCGGACCGTACTCCCACCTCCGCCTGGGGCCGGGAACCCT[C/T]GAGGTGACCGGCCCTTTGCACGTTTACCCAATTCCCACCGGCCACCGCTC
Associated Phenotype:
Not determined