Busch Lab

ZMP

tmtc1

Ensembl ID:
ENSDARG00000063149
ZFIN ID:
ZDB-GENE-070705-219
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW25]
Human Orthologue:
TMTC1
Human Description:
transmembrane and tetratricopeptide repeat containing 1 [Source:HGNC Symbol;Acc:24099]
Mouse Orthologue:
Tmtc1
Mouse Description:
transmembrane and tetratricopeptide repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:3039590]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa13541 Essential Splice Site Available for shipment Available now
sa20209 Nonsense Available for shipment Available now
sa18061 Essential Splice Site Available for shipment Available now
sa26220 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa26221 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33390 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13541
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 163 872 2 20
ENSDART00000142892 Essential Splice Site 163 412 2 9
Genomic Location (Zv9):
Chromosome 4 (position 8476646)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9404154
GRCz11 4 9405070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCCTCACCGCACTGCTKTTCTCTGTGCACCCCATTCACACTGAAGCTG[T/A]GAGTCTGCCAATACRACTAATACTAATATATGCATTACTAGTTATGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20209
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Nonsense 288 872 6 20
ENSDART00000142892 Nonsense 288 412 6 9
Genomic Location (Zv9):
Chromosome 4 (position 8500515)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9428023
GRCz11 4 9428939
KASP Assay ID:
2259-4517.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTTCAGGTTACAGTCATCATGTCTGTCCGCTTATGGCTGATGGGT[G/T]GATCCATGCCGCTGTTCTCCGAGCAAGACAATCCTGCATCCTTCTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 372 872 8 20
ENSDART00000142892 Essential Splice Site 372 412 8 9
Genomic Location (Zv9):
Chromosome 4 (position 8501373)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9428881
GRCz11 4 9429797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCTCTTGTCATGCTGGCATTRAGCCTGAACTGTGTTACATGCCTACAG[G/T]TGAGCGATTGAACGCACACATTTCCAMGTGACAAGACAACCTCTGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26220
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 507 872 11 20
ENSDART00000142892 None None 412 None 9
Genomic Location (Zv9):
Chromosome 4 (position 8519654)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9446906
GRCz11 4 9447822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGGCGAAACCAAGAAGCCATTTACCACTATAAAACAGCCCTCAGG[T/G]ACTGTAAATCCGTGTACGTGATGCTAAACAAAATATTTAGAGAAAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 592 872 14 20
ENSDART00000142892 None None 412 None 9
Genomic Location (Zv9):
Chromosome 4 (position 8521131)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9448383
GRCz11 4 9449299
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCTTTTACGCTGATGTTTACCCTGTTATACTTTTTTTTGTGTGTGTGT[A/G]GGGACACTCAAAAGAAGCGAATGAGATTTATACCAAGGGTATTGAGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33390
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Essential Splice Site 719 872 16 20
ENSDART00000142892 None None 412 None 9
Genomic Location (Zv9):
Chromosome 4 (position 8522751)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9450003
GRCz11 4 9450919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGGCGTCCACACTGCAGCCTGACAGCACAGATATCTGGCTAGCCCTG[G/T]TGAGATTACACTCAAACGTTAGCCTAAAAAAAACATCCCATCACTTCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26222
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092013 Nonsense 796 872 18 20
ENSDART00000142892 None None 412 None 9
Genomic Location (Zv9):
Chromosome 4 (position 8527888)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9455140
GRCz11 4 9456056
KASP Assay ID:
2259-4521.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGCCTGCGGTGAGGGCAGAGCTGCACTTCTCAATGGGAAACCAGCTT[C/T]GAGAAATGAACGAGCTGGATCGAGCCTTCCAGGTAAAAGCTCACTTCCAG
Associated Phenotype:
Not determined