Busch Lab

ZMP

si:dkey-21p9.4

Ensembl ID:
ENSDARG00000063140
ZFIN ID:
ZDB-GENE-091204-175
Human Orthologue:
EXD3
Human Description:
exonuclease 3'-5' domain containing 3 [Source:HGNC Symbol;Acc:26023]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10072 Essential Splice Site Available for shipment Available now
sa9133 Nonsense Mutation detected in F1 DNA Not yet available
sa34858 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10072
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Essential Splice Site 164 861 4 19
ENSDART00000138041 None None 339 None 8
Genomic Location (Zv9):
Chromosome 10 (position 10912582)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10988448
GRCz11 10 10946686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGTTCAGTGTGAAAATGGAGCTCCAGTCAGATCTGGAYATGGAGAAGG[T/G]KAGTCTCTGTTCATCTGGACTGTTTTATTTCTGTGTGTTTGTGTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9133
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Nonsense 189 861 5 19
ENSDART00000138041 None None 339 None 8
Genomic Location (Zv9):
Chromosome 10 (position 10912431)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10988297
GRCz11 10 10946535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGACAAGCTGTCTCTGGCTGAGCTCTAYGTTCGTCATCATCCAGATCTG[C/T]AACAGAGACTCGTATCCCTCCTGGACTCCTGGTGCCGGCCAGACTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34858
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Nonsense 591 861 14 19
ENSDART00000138041 Nonsense 210 339 5 8
Genomic Location (Zv9):
Chromosome 10 (position 10901318)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10977184
GRCz11 10 10935422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGCCAGAGGATCTTCGCTCTATTCCCACAGCCCAGAAGCCCAAGAGC[C/T]AAGAGGAGAAAAAGCCCAAAGACAAGAAGCAGTTTAAAAGAAGAGAGGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1063
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092011 Essential Splice Site 735 861 17 19
ENSDART00000138041 Missense 339 339 8 8
Genomic Location (Zv9):
Chromosome 10 (position 10895974)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10971840
GRCz11 10 10930078
KASP Assay ID:
554-0966.1 (used for ordering genotyping assays)
KASP Sequence:
ACATTTTCACGTWCACCTTRCTCCAGCAGACATATTCAGCCGTTGCCAGG[T/G]CAGTTGTGAAAGTCTGTCTCAAAAACCTNNACCTTTTTAAAAGGAATGGT
Associated Phenotype:
Not determined