Busch Lab

ZMP

crebbpb

Ensembl ID:
ENSDARG00000063102
ZFIN ID:
ZDB-GENE-050302-102
Description:
CBP-A [Source:UniProtKB/TrEMBL;Acc:Q1L668]
Human Orthologue:
CREBBP
Human Description:
CREB binding protein [Source:HGNC Symbol;Acc:2348]
Mouse Orthologue:
Crebbp
Mouse Description:
CREB binding protein Gene [Source:MGI Symbol;Acc:MGI:1098280]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38373 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33098 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa919 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38373
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 418 2424 5 31
Genomic Location (Zv9):
Chromosome 3 (position 10029179)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9707694
GRCz11 3 9675296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGTCTGTCTGCCCCTGAAAAATGCCAGTGACAAGAGAAACCAGCAGC[G/A]TAAGTCATCCTCACATTTACATCAACTACACACATGCAGATATTCAATAA
Long Flanking Sequence:
AGACTTGTTTTACATTTTGTAAAAAGGGGAAAAAAAGTCCCCTTAAAATAAACAATCTAATAAATGATTTGCACATTCTCATTCACATGCTGTGAGCTCTGGTTTTATATAAAAATCTTTAAATTGTGCCTCGCAGTCATGTTAGGATATTACCGTAGTCATTGTTGGTGTTTTAAAACAACATTGCTACGTAAACCTATTGTTCTTTTTCAGTTTAATCAACTTTAAATTAAAAAAGTCCCTGTTTACTTTGTAACCAACCACCTAATAACAACTCACACATTTCCAACTAGTTATTCATTCCAACCGTTTCATTCATTTGCTTGTGTGTTTGGAAAATAGAGTTGGGATTTTGAAGCTTAAATTCTTTTGTGGACTTTTCACAGTGGCTCACTGCGCCTCATCAAGACAGATCATCTCACACTGGAAGAACTGCACCCGGCACGACTGCCCTGTCTGTCTGCCCCTGAAAAATGCCAGTGACAAGAGAAACCAGCAGC[G/A]TAAGTCATCCTCACATTTACATCAACTACACACATGCAGATATTCAATAATTCAATGTGTCGTCAAATTGAACATGCTCTATTTGTATCAGGGCTTTTACTTATGATTCTCCGACACTGTGGAGTTCTCTTTCAGTTGACATCAGGATTCTTGCTGTTTTTACATCTTAAAACCATTTTGTTTAGGATTGCTTTTGTTAATCTATTTTGTATTATCTGTTTTTCTTTTATCATTGTTGTATTTTTATGTATGTTGTCTTTGGGTGCTTTCACACCTGCCTTATTTAGTTCGATTGAATCGCACTAGAGTTCGTTTCCCCTTTTGGTGCGGTTCGTTTGGGCAGGTGAGAATGCAGCAATCGTACTTGAGTGCGCACCAAAAGCGGACCAAATAAGCGTACCGAGACCTGCTTGTAGAGGTGGTCTTGGTACGCTTTCAAACGAACCCTGGAGCGGTTCGTTTGTGGTGAGAATATGATCCGTACTAAAACAGGTCCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33098
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 419 2424 None 31
Genomic Location (Zv9):
Chromosome 3 (position 10029180)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9707693
GRCz11 3 9675295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTCTGTCTGCCCCTGAAAAATGCCAGTGACAAGAGAAACCAGCAGCG[T/A]AAGTCATCCTCACATTTACATCAACTACACACATGCAGATATTCAATAAT
Long Flanking Sequence:
GACTTGTTTTACATTTTGTAAAAAGGGGAAAAAAAGTCCCCTTAAAATAAACAATCTAATAAATGATTTGCACATTCTCATTCACATGCTGTGAGCTCTGGTTTTATATAAAAATCTTTAAATTGTGCCTCGCAGTCATGTTAGGATATTACCGTAGTCATTGTTGGTGTTTTAAAACAACATTGCTACGTAAACCTATTGTTCTTTTTCAGTTTAATCAACTTTAAATTAAAAAAGTCCCTGTTTACTTTGTAACCAACCACCTAATAACAACTCACACATTTCCAACTAGTTATTCATTCCAACCGTTTCATTCATTTGCTTGTGTGTTTGGAAAATAGAGTTGGGATTTTGAAGCTTAAATTCTTTTGTGGACTTTTCACAGTGGCTCACTGCGCCTCATCAAGACAGATCATCTCACACTGGAAGAACTGCACCCGGCACGACTGCCCTGTCTGTCTGCCCCTGAAAAATGCCAGTGACAAGAGAAACCAGCAGCG[T/A]AAGTCATCCTCACATTTACATCAACTACACACATGCAGATATTCAATAATTCAATGTGTCGTCAAATTGAACATGCTCTATTTGTATCAGGGCTTTTACTTATGATTCTCCGACACTGTGGAGTTCTCTTTCAGTTGACATCAGGATTCTTGCTGTTTTTACATCTTAAAACCATTTTGTTTAGGATTGCTTTTGTTAATCTATTTTGTATTATCTGTTTTTCTTTTATCATTGTTGTATTTTTATGTATGTTGTCTTTGGGTGCTTTCACACCTGCCTTATTTAGTTCGATTGAATCGCACTAGAGTTCGTTTCCCCTTTTGGTGCGGTTCGTTTGGGCAGGTGAGAATGCAGCAATCGTACTTGAGTGCGCACCAAAAGCGGACCAAATAAGCGTACCGAGACCTGCTTGTAGAGGTGGTCTTGGTACGCTTTCAAACGAACCCTGGAGCGGTTCGTTTGTGGTGAGAATATGATCCGTACTAAAACAGGTCCAACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6878
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 495 2424 None 31
Genomic Location (Zv9):
Chromosome 3 (position 10035477)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9701396
GRCz11 3 9668998
KASP Assay ID:
554-4902.1 (used for ordering genotyping assays)
KASP Sequence:
GGACAGCAGCCCACRCAGACGCAGCAGATGCGCTCCATGGCCGCATTAGG[T/G]ATCAACACATGGAAATGTCAAATTGTTATTAGTGGTTGGCTGAAAAGCAG
Long Flanking Sequence:
TCTGTCACACTCATTACAGGCGTTTCTGTCTCTGCTAATGAGCTGATGATCTGAATCAGGTGCGTCTATTTAAGGAGACATAGAAAATGTGCAGAGTTGGTGGTCCTCCTGGAACGTGGTTGAGAAACACTGCTTTTTAAAGAGTAAAAATTTATTTTATGTGTTTTTCTTTAAAAATTTAAGGGATTTTAAAGAAGCAGCAGTGGCTTTATATTTTATTTAAATCATGGATATCTGAATTGACCGAAGGTCTTCTGTGTGTGATTTGCAGCGATGCTGAGCTCCCCGAATCCTGGCATGCAGTCTCCGCTGGGGCAGGTGGGCACGAGTCAGCCTGCGGCGCCCGCCATCAGCAGCGGCACACACATCGACCCCAGCTCCATGCAGAGGGCGTACGCAGCGCTGGGCCTCCCGTACGGGAATCAGCCCGCCGCACAGACACAGGTCGCAGGACAGCAGCCCACGCAGACGCAGCAGATGCGCTCCATGGCCGCATTAGG[T/G]ATCAACACATGGAAATGTCAAATTGTTATTAGTGGTTGGCTGAAAAGCAGAATTTTTTTTTTTATCCATTTTCATTATTAACCTTGAAAGCTGCTGCCATTCTATAACCTCCATCTTTCATGCTGTTGAGCTATACAAATTACTTTATATTAGGGCTGCATCTGACATTTAGATTTTTTTTTTTCTGCGATACGCACTCAATGGCCACTATATTAGGTACACCTTACTAGTACCGGGTTGGACCCAATTTTGCCTTCTGAACTGCTTTAATACTTCGTGGCATAGATATAACAAGGTACTGGAAATGTTCCTCCGAAATTTTGGTCCGTATGGACATGATAGCATCACACAGTTGCAGCAGATTTGTCAGCTGCACATCCATGATCCAAATCTCCCGTTTCACCACATCCCTAAGGTGCTCTATTGGATTGAGGTCTGGTGACTGTGGAGGTCATTTGAGTATCAACAAGACATTTGCAACCACAGAACTGCCACTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa919
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091873 Essential Splice Site 525 2424 8 31
Genomic Location (Zv9):
Chromosome 3 (position 10040259)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 9696614
GRCz11 3 9664216
KASP Assay ID:
554-0825.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAATGTCAAGCATGGTTTATAATCTAATGTYATTATCCCGCACCCAC[A/T]GCCAGATGATGCCCGACGGGTCGAATATGGGYGGCGCAGGGAACCTGCCC
Long Flanking Sequence:
TAGATATACATGACAATTATCATTTTTAAAATTTCAATTATTTTTAAAGAAAAGATTTGTTGAATTAAAAGTGCATGTACACAGCTATATTTTGCTTGTTTTGACCCATTATTTAAAATTTGTGGCTAAGAAATAATAATTTATTTATTTTTGGTGTGGTCAGAGTTAAATTTGGCAAATCCTTAATTTTGAGCCCCAGAAAGTCATGTGAAATAAAAAAAAAATATTTGCAATGCGACAATGAGACCTCAACTCATATGCTCATGCACACTGAGCAAGCTCATACACAACACACACAAAAAGTGAAATGGAGGCATGTGGATATAACACAAAATCTAAATCAAGACATTTTAGCATGTCAAATTTATGCAAATAAAATATATTTTCCAACAACAAATGTGTGGCTAGTGAAAATGGCGAGTGGCTAGTAATCAACAGCGGCTGGTGATCAAAAAATGTCAAGCATGGTTTATAATCTAATGTTATTATCCCGCACCCAC[A/T]GCCAGATGATGCCCGACGGGTCGAATATGGGTGGCGCAGGGAACCTGCCCACTGCTGCGCCGCTGTCGATGCCCGGCATGAAGAAACCCTGGCACGAGCACGTCACTCAGGACCTGAGGAATCACCTAGTGCACAAGCTGTGAGTTCAACAGATCAAACATCAATATTGTGTTTTGTCATATGCTGCTTTTTTTTACACAGTGTGTTCTCCTAATGCTCCTACAGAGTTCAAGCCATATTCCCGACTCCTGACCCTGCAGCACTGAAAGACAGACGCATGGAGAATTTGGTTGCTTATGCACGGAAAGTGGAGGGAGACATGTATGAGTCTGCCAACAGCAGGGTAAGACACACAAACATTCCTGCTACATTCAGACTCTCACAGGGTCCCCGCGGGTCCTGTAAAAGTTTTGAAATGTCTAGAAATGTCTAATTTTCCATAAGGAGGTCTTCGATTTCATGTGGGATCTTAAATTTCATATCCAACTCGTCATTTTTAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461