Busch Lab

ZMP

si:dkey-223d9.2

Ensembl ID:
ENSDARG00000063089
ZFIN ID:
ZDB-GENE-090313-248
Human Orthologue:
C20orf160
Human Description:
chromosome 20 open reading frame 160 [Source:HGNC Symbol;Acc:16153]
Mouse Orthologue:
BC020535
Mouse Description:
cDNA sequence BC020535 Gene [Source:MGI Symbol;Acc:MGI:2385159]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29876 Nonsense Mutation detected in F1 DNA Not yet available
sa6724 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29876
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091899 Nonsense 123 613 4 10
ENSDART00000140455 Nonsense 123 147 4 4
ENSDART00000144533 None None 100 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9161764)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9119905
GRCz11 23 9054875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGGACTGTATTCTCAGTCTGTCTGCTCGCTGTCTGCTGCTTACCTGG[A/T]GAGACAATGAAAAACTGCTGCTGAGGATCCCTACACATGAAATTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6724
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091899 Essential Splice Site 403 613 6 10
ENSDART00000140455 None None 147 None 4
ENSDART00000144533 None None 100 None 3
ENSDART00000091899 Essential Splice Site 403 613 6 10
ENSDART00000140455 None None 147 None 4
ENSDART00000144533 None None 100 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9169871)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9128012
GRCz11 23 9062982
KASP Assay ID:
554-4241.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGCRGGTTTTCAYTACACCATGCCTGACCGCTATTGGCTGCAGAGGAG[T/C]AAGTGGTGTCTACATTGCTCATTAGAAGCTAGTTAGCTGTAACCAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37618
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091899 Essential Splice Site 403 613 6 10
ENSDART00000140455 None None 147 None 4
ENSDART00000144533 None None 100 None 3
ENSDART00000091899 Essential Splice Site 403 613 6 10
ENSDART00000140455 None None 147 None 4
ENSDART00000144533 None None 100 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9169871)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9128012
GRCz11 23 9062982
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCGGGTTTTCACTACACCATGCCTGACCGCTATTGGCTGCAGAGGAG[T/A]AAGTGGTGTCTACATTGCTCATTAGAAGCTAGTTAGCTGTAACCAAGCTA
Associated Phenotype:
Not determined