Busch Lab

ZMP

abcg5

Ensembl ID:
ENSDARG00000063078
ZFIN ID:
ZDB-GENE-050517-40
Description:
ATP-binding cassette sub-family G member 5 [Source:RefSeq peptide;Acc:NP_001122162]
Human Orthologue:
ABCG5
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 5 [Source:HGNC Symbol;Acc:13886]
Mouse Orthologue:
Abcg5
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 5 Gene [Source:MGI Symbol;Acc:MGI:1351659]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa22240 Essential Splice Site Available for shipment Available now
sa17622 Nonsense Available for shipment Available now
sa2683 Nonsense F2 line generated Not yet available
sa42150 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22240
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Essential Splice Site 92 652 2 13
Genomic Location (Zv9):
Chromosome 13 (position 10513080)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10815409
GRCz11 13 10947884
KASP Assay ID:
2260-6109.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATTTCATTTGGACAGTGGCCAGATAATGGGAATTCTTGGAAACTCAG[G/A]TAAATGTCTTAAAATCTGTGAGAAAAAGAATGACTGCAATGCTTTCAATT
Long Flanking Sequence:
AGCTGGAACTGTTTACAGGTAACGATTAAAATAAAATTCAATTCATGTTTATTTCTATAGCACTTTTACAATGTAGATCGCGTCAAAGCAGCTTAAGATAGAAGTTTAGTAAATTGAATCTGTGTCAGTCCAGTTTTCAGAGTTTAAGTTCAGTTTAGTTCATTTCAGTGTGGTTTTAATCTCACAGCTGAAAGTCCAAACACTGTTGAGCAAATCCACCGATACGCAGCTTAACAAGTCCCAAAACAATTAAGCCAGTGGCGAGGAACAAACTTCACCAGTTGACTAAAGTGAAGGGAAAAAAATATTGTCCAAAATATTGATAAGCTAACATTTTTATGCTCATATCATATACATTTTATTTTTTCACTGTTACAGTGAACGTGTAGGACCCTGGTGGGATCTTTCATCTTTTCGAAAAAAATGGACAAGGCAAATATTAAACGAAGTGTCATTTCATTTGGACAGTGGCCAGATAATGGGAATTCTTGGAAACTCAG[G/A]TAAATGTCTTAAAATCTGTGAGAAAAAGAATGACTGCAATGCTTTCAATTATAACACATTGTTAGAACAGAGCCTAGCTAACATGCTATTGACTTATAAATATGTTCATTTGTGAAATTTACTGTGATATTTCACTCAAAGATGAACATTTAAAGTGTTTATTTCTCCCTCAAGTGGTTGCAAACCCTTATGAGTTTCTTTATTCTGTTAAACAAACAAGATCTTTTGAAGAAAGCTGAAAACTGATAACCCCTGACATTCATAGCAGGAAAAATAATAATACTAATATGTAAGTCAGTGGTTACAGGTTTCCAACTCTTTTTAAATGATCTTCATCTGTGTTCAACAGAAGAATTACAAATAGATTTGGAAGGAGTGGAGGATGAGTAAAAGATGACAAGGTTAAAATTTTTGGGTGAACTCTCCCTTTAACTAAATACAATTTAATATAAGATGTTTTAAAATATAACAAAAAATAATAATATTTACAAATCTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17622
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Nonsense 128 652 3 13
Genomic Location (Zv9):
Chromosome 13 (position 10513850)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10816179
GRCz11 13 10948654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCWACCTYCAGGGAGAAGTGTTTGTGAATGGACGAAAGCTRAAAAGAGAA[C/T]AGTTTCAAGACTGTTTCTCTTMCGTTCTGCAGGTGAGATTAAWTGTTATT
Long Flanking Sequence:
AAAAATAATAATACTAATATGTAAGTCAGTGGTTACAGGTTTCCAACTCTTTTTAAATGATCTTCATCTGTGTTCAACAGAAGAATTACAAATAGATTTGGAAGGAGTGGAGGATGAGTAAAAGATGACAAGGTTAAAATTTTTGGGTGAACTCTCCCTTTAACTAAATACAATTTAATATAAGATGTTTTAAAATATAACAAAAAATAATAATATTTACAAATCTTTCCCAGTATTGTTAAACGTATATGGATTAGAACATGACAATAAGCAATAATAAAGAATGAACCTGGAAATGTATTATACACTTATATTACATTTACAATACATAATAGTTTCTTTAAAAGTCAGATGATATCCTCATATGGTAATAAACGTTTTGATCTTCTCCTTAAGGTTCTGGAAAGACCACTCTGTTAGATGCTATAGCAGGGCGCATTGGGAATTCTGGCAACCTCCAGGGAGAAGTGTTTGTGAATGGACGAAAGCTAAAAAGAGAA[C/T]AGTTTCAAGACTGTTTCTCTTACGTTCTGCAGGTGAGATTAATTGTTATTAAAGGTAAAATTCCCCCAAAATGACAATTTACTGAGTATTTACTCAACTGCAGGTGCTTATAAACCTTTATGAGTTTCTTTCTTCTGTTAAACACAAAAAGAAAGTTGAAAACCAGTAACTATTGATTCCCATATAGAAAAAAATAAATGCATGTCAATAGTTATAGGTTTTCAACTTTCTTCAAAATATCTTACTTTGTATATAAAAGAAGAGAGAAACTCATTATGTGTGCATGCTTCAAGTATAAATGTCAAGATGCATTTAACTGAACTCTGGCCAACAGTAGTGTACAGTATACATATGAAAAGCGATTGACTGACTGGAGGTCGCGTCTGCTGTGACCAAACTTAAGCAAATACAGTAAAGTTTGTAGAAAAGTTCATCTGTAGAGTCCGCTCTGAAATTGGCCGTTACACATGAGTTGGTTATAATATTCTTCTGAGCTACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2683
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Nonsense 436 652 9 13
Genomic Location (Zv9):
Chromosome 13 (position 10525121)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10827450
GRCz11 13 10959925
KASP Assay ID:
554-2577.1 (used for ordering genotyping assays)
KASP Sequence:
GTACAGGACCGAATCGGCCTAATCTACCAATCCATGGGTGCATCTCCCTA[T/A]ACCGGAATGCTGAATGCTGTGGCTCTATGTAAGTATACAGATAACAATCG
Long Flanking Sequence:
GTACAAGTATTGTTTATTTTTAGTTTACTCATCCTCCACTTGCTTCAAACCTGTTTGAGCTTCTTTCTTCTGTTGAACTGTGGATATTAAAGATGTCAATGGCTGTTTTTTTTCCCCTGATCATCTTCATAATATTGTGCTTTGTGTTCAACGGAAAAAATAAATTCATAGTTAATGAGTTAATGTTGAGACAATTTTCATCTCTTTAACTAAAATGAACTAACGGAACCTTGTTTTAAAATGTGACTAGATTATCTTAATAGTCCATAATGTTAATGCTATATTTATTCATACATTTTTTGCTCCTTTACATGCACACATAGACGGACCTTTCGCAACGTGTCCCGTGACAGGATGGGTATTCTCATGCGTCTCTCTCAGAATCTCATCTACGGCCTCTTCATTGCTTTTTTCCTCATGAGGCTTGGTAAGGATGTGACAAAAGGTGCCGTACAGGACCGAATCGGCCTAATCTACCAATCCATGGGTGCATCTCCCTA[T/A]ACCGGAATGCTGAATGCTGTGGCTCTATGTAAGTATACAGATAACAATCGATGTATTGTTCTATGCAGCCTGCAATCTGAGTGAAATCATTTTCCATCATGATTTACAAGAACAGCATATAATTCTTTTACCTGTATTTACTAAAATATGTAAAATGTTAATCATACAAATTTTTATTTTTGTTTTGGGTAAATGGGTAAATCTAGTGGTTTAAGGCAGGTTTTATCAAACTTTTCAGCTTGCGAACCCCAAAATAATTCCAGTGACTCGTGACCCCCACTATTCATGGAGGTGGTTTCAAACATGCAAACATTGCACAGACACACTAATAGAAACTATATAAGCAAGCTTATTGACAACACAAAATCATGCAACGGAATAAAAACCATATAATTTTTTATAGTCGTTATTCATTAGTTTAGTTTAATATTAACCTCACCTAATGAGAATGGTAGGCATAATAATTACAGCACAAGATTCTTGGTTTAATTTTAGAGAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28072
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Essential Splice Site 554 652 11 13
Genomic Location (Zv9):
Chromosome 13 (position 10529771)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10832100
GRCz11 13 10964575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCTCTCCTCAATATAGCAGGAATCATGGTGGGCTCTGGATTTCTGAGG[T/C]GAAGAAATTATTTTGATTTTCAAATGTCAAAATATTGTTTTGATTCATCA
Long Flanking Sequence:
TTTTCTTTTTTCCAACAGTCCCTGCTTTGCGGGCCATTTCTGATCAGGAGAGTAAAGATGGTTTATACCAGAAATGGCAGATGTTTCTGGCTTACATCATCCATATCCTACCCTTCAGTATTATCAGTGTGTTCATCTTCGCCTCATTCCTGTATTGGTAAGTATGGGTGTGTGTTTGTTTGAGCAACTCGAGTTCATCCGAGCTTGCGTCGGGGTAACTTGGGTTCAGATGTCAGGGCAATGTCCGCGGGATCAAATAAAGCAAGCGCTTTGTGAATCGTGACCACATGCAGTGTTTGTTTCTGTGTTTTAGGACAGTAGGCATGAACCCAGATCCTGTGCGCTTCCTGTGTTTTTCAGCCGTGGTCATGGTGCCTCACATCATTGGTGAACTCTTAACACTGGTCTTGTTGGGTGTCGTCCAAGACCCCAATATGGTCAACAGTGGAGTCGCTCTCCTCAATATAGCAGGAATCATGGTGGGCTCTGGATTTCTGAGG[T/C]GAAGAAATTATTTTGATTTTCAAATGTCAAAATATTGTTTTGATTCATCAGCTGTGTCCGAAATCACATACCTCCCTACTATATAGTATGTGAAAAACAGAATGTAAGCCAACTGCTGTAGTAAGTCCAAATTCATAATATTCAAAAAACAGTAGATGAGAAGTACTTAGATGACCTACGACAGGGGTCCTCAAACTCCTCGAGGGCCACAGCCATGCACACTTTAGTTCAGTCTCTGCTTCAACACACTCACATTTAAAAAAAAAGTCTAAGTCTAAGACTCATTTAGTTTGATCAAGTGAGTTTAATAAAGGTTAGAGCTAAACTGTAAAGTAAAGGTCCTGTATTACCGCGGGACCTGACCAGATTTCTTGGTCGGGTAAATTTCTGAATAAATTGCGGTAGCGGTCGGTAACTCTGGTGTAATTTGAACTGGAGCAGGCGGGTTAGCAATTTAGCATTCCCAAGTCCCTATGTTATTTCGGAACATAATATCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42150
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091845 Nonsense 612 652 13 13
Genomic Location (Zv9):
Chromosome 13 (position 10533341)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10835670
GRCz11 13 10968145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCTTGCCAGGAGAGTGTCTGGTAGACAGTGGGAATATGATCATAGAT[C/T]AGGGTTATCCTGGAGCTCTGTCCCGTTACACTCAAGACTTCCTGTTGCTC
Long Flanking Sequence:
GCGGTGTAGGTGAATTGGGTTGGCTAAATTGTCCGTTGTGTATAAATGTGTGAATGGGGGTTTCCCAGTGATGTGTTGAGGCTAAAAGGGCATCCACTGCATAAAACATATGCTGTATAAGTTGGCGGTTCATTCTGCTGTGGCGACCCTAGATTAATAAAGAGACTAAGCCGAAAATAAAAAAAAATGAATGAATGAATGAATGCTTACAAAATAATGGTGCACAAACATCGTTTATAACAAGCACTACTAAATACATATGAAAATAAGAAGTCTATTTTGATTTCATTCTGACTTTAAGTGCATCACTGCAGAATAAAAGATATTTTTGAACAAATTTTTTATATCACTTTTGCCTGAATCTTATTTCGATTCACTGTTTTTAACAGATATAATGCATACGTTTTCCAGACTAACCACTTTTCTCTCTCTCACTCTCAGCCCCTATAGCTGGCTTGCCAGGAGAGTGTCTGGTAGACAGTGGGAATATGATCATAGAT[C/T]AGGGTTATCCTGGAGCTCTGTCCCGTTACACTCAAGACTTCCTGTTGCTCTATGCCTTCCTGCCCGCTCTTGTGATCCTGGGCATCATCAGCTTCAAGATACGAGACCACCTCGTCAGACGCTGAGCCTCCATGTGTGTGCACATGTGTGTGTGTTATTGTGTACAGAATGCTATGTTCTTTATTTGTATTTTTGTAGATCATATATTGTAGGTTATATCCAGACAACATCACCATGGGAGCTAATGCTTTTCCAATGAAACACATCAATTTTCTTCGTAAAGTTTTGTACTATAATGTGATTTTAAATGTGACTGAACAAATAATCTATTATTATAAGACACCTGTTTTGTCTTTGCTGGTCATTAGTGCATATTATTGCAGCCACATTTCTTTATACAAGATGTTATGTTTCATTCTGCTGGCTGTAACATGTAACCTAATAAACAACTTTGCCTGCTTTAAGGCTTTGAGATTTATTCTCTTTCTCAATTATGATAA
Associated Phenotype:
Not determined