Busch Lab

ZMP

btbd11b

Ensembl ID:
ENSDARG00000063040
ZFIN ID:
ZDB-GENE-050419-99
Description:
Ankyrin repeat and BTB/POZ domain-containing protein BTBD11-B [Source:UniProtKB/Swiss-Prot;Acc:P0C7A
Human Orthologue:
BTBD11
Human Description:
BTB (POZ) domain containing 11 [Source:HGNC Symbol;Acc:23844]
Mouse Orthologue:
Btbd11
Mouse Description:
BTB (POZ) domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1921257]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa8602 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32195 Nonsense Available for shipment Available now
sa23258 Nonsense Available for shipment Available now
sa39195 Nonsense Mutation detected in F1 DNA Not yet available
sa2959 Essential Splice Site F2 line generated Not yet available
sa23257 Nonsense Available for shipment Available now
sa16940 Nonsense Available for shipment Available now
sa12869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Essential Splice Site 405 1012 4 17
Genomic Location (Zv9):
Chromosome 18 (position 14570426)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15015844
GRCz11 18 14984356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACTTACAATGTTTTTATAGCACWGTAATCACCTGTTGTCTCCCCCTGC[A/G]GGCCGTTTCTRGTGCTGCCTCCTCTGATGGAGTGGATCAGAGTGGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32195
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 697 1012 10 17
Genomic Location (Zv9):
Chromosome 18 (position 14555943)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15001361
GRCz11 18 14969873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACCTGGAGGAGAGGAATTCCCTAAAGATGGAGGCGACCCGCACGGGG[A/T]AAGCCAAACTCAAAGCGCTGAGGGAGGCCATGTATCACAGCTCCGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 715 1012 10 17
Genomic Location (Zv9):
Chromosome 18 (position 14555887)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15001305
GRCz11 18 14969817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTCAAAGCGCTGAGGGAGGCCATGTATCACAGCTCCGAACATGGATA[C/A]GTCGACATCACCCTGGACATCAGAAGTCTAGGTCAGTTCCTGCTGTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39195
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 779 1012 11 17
Genomic Location (Zv9):
Chromosome 18 (position 14554617)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15000035
GRCz11 18 14968547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAATATACAGAGGAGCTCATCACACACGGCCTCCCTCTCATGTTC[C/T]AGATCCTGCGCGCCAGCAAGGTGAACTAAAACATTTACACATTTGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2959
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Essential Splice Site 820 1012 12 17
Genomic Location (Zv9):
Chromosome 18 (position 14549699)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14995117
GRCz11 18 14963629
KASP Assay ID:
554-2749.1 (used for ordering genotyping assays)
KASP Sequence:
TCCCATTCCAAAACTGACCRAGATCAAGAGGAAACAGACCTCAAGACTGG[G/A]TACGTACTGTAAAGAGATCAGCTTTCATCACCAGAACAAACTGACTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23257
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 922 1012 16 17
Genomic Location (Zv9):
Chromosome 18 (position 14545368)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14990786
GRCz11 18 14959298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTCTGCATCTAAGTTCTTCCAGCTGGAGGCATTACAGAGACACTG[T/A]GAGATCATCTGCGCCAAGAACATCAACACCGAAACTTGTGTGGAGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16940
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 976 1012 17 17
ENSDART00000091742 Nonsense 976 1012 17 17
Genomic Location (Zv9):
Chromosome 18 (position 14542346)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14987764
GRCz11 18 14956276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAACATGGCRGTTCTCATAGAGCTTGAGCCATTTAAACAGTTGCTCTA[T/A]AACACCCCGGTGGAGAACTGCTGTCCTGACGTGTTGCATGACCTGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12869
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091742 Nonsense 976 1012 17 17
ENSDART00000091742 Nonsense 976 1012 17 17
Genomic Location (Zv9):
Chromosome 18 (position 14542346)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14987764
GRCz11 18 14956276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAACATGGCRGTTCTCATAGAGCTTGAGCCATTTAAACAGTTGCTCTA[T/A]AACACCCCGGTGGAGAACTGCTGTCCTGACGTGTTGCATGACCTGGAGAA
Associated Phenotype:
Not determined