Busch Lab

ZMP

si:dkey-42i9.10

Ensembl ID:
ENSDARG00000063031
ZFIN ID:
ZDB-GENE-030131-3097
Description:
Novel protein similar to human and mouse steroid receptor-interacting SNF2 domain protein (Srisnf2l)
Human Orthologue:
RAD54L2
Human Description:
RAD54-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:29123]
Mouse Orthologue:
Rad54l2
Mouse Description:
RAD54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6696 Nonsense Mutation detected in F1 DNA Not yet available
sa43779 Nonsense Mutation detected in F1 DNA Not yet available
sa37441 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6696
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091716 Nonsense 374 1437 7 21
ENSDART00000147975 Nonsense 243 1306 5 19
Genomic Location (Zv9):
Chromosome 22 (position 10732406)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10592574
GRCz11 22 10622256
KASP Assay ID:
554-5018.1 (used for ordering genotyping assays)
KASP Sequence:
TTAACCTCTGGCTGCCTGCWGCTGAGGCTCTGCCCCCTGACACKGACCCA[C/T]AGCAGGTCTTACCTCGAAYCTTCAAGGTCCACATCCTCAACGACGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43779
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091716 Nonsense 481 1437 9 21
ENSDART00000147975 Nonsense 350 1306 7 19
Genomic Location (Zv9):
Chromosome 22 (position 10736786)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10596954
GRCz11 22 10626636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGGGCCGGATGTGGTGATTTGTGACGAGGGTCACCGCATTAAGAACTG[T/A]CACGCCAGCACCTCTCAGGCCCTGAAGAACATTCGTTCACGCCGGCGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37441
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091716 Nonsense 651 1437 11 21
ENSDART00000147975 Nonsense 520 1306 9 19
Genomic Location (Zv9):
Chromosome 22 (position 10739233)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10599401
GRCz11 22 10629083
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCAGATGTTTTGTACGAGGCTCTGCAGAAGGAGAATCTGGCCAATGAG[C/T]AGGATCTGGATCTGGATGATCTGAACTCCTCCAGCGGGACGCGCTGCTCT
Associated Phenotype:
Not determined