Busch Lab

ZMP

si:dkeyp-27e10.3

Ensembl ID:
ENSDARG00000063008
ZFIN ID:
ZDB-GENE-041210-96
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVS7]
Human Orthologue:
KIAA1549
Human Description:
KIAA1549 [Source:HGNC Symbol;Acc:22219]
Mouse Orthologue:
D630045J12Rik
Mouse Description:
RIKEN cDNA D630045J12 gene Gene [Source:MGI Symbol;Acc:MGI:2669829]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20213 Essential Splice Site Available for shipment Available now
sa20212 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3507
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091694 None None 748 None 14
ENSDART00000146858 Nonsense 718 1447 9 20
Genomic Location (Zv9):
Chromosome 4 (position 8857792)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9794640
GRCz11 4 9795556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAATGGAGCGACGATTAGCATTGCTGGTTGGAGAAGGACTTGGGATC[G/T]GAATTAACAATCGACGATGGAGAAGATCTACTAGTGTTGGCAACAATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20213
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091694 Essential Splice Site 315 748 5 14
ENSDART00000146858 Essential Splice Site 1044 1447 14 20
Genomic Location (Zv9):
Chromosome 4 (position 8854322)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9791170
GRCz11 4 9792086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAATCTGACAGACAAGATTACTGACGGAGCAAAGGTCAACAGTGAGG[T/C]TAGCAAACATTCATGTTTACCTTCCGGGATGTGCCTTTTTAAAGAGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20212
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091694 Nonsense 365 748 6 14
ENSDART00000146858 Nonsense 1094 1447 15 20
Genomic Location (Zv9):
Chromosome 4 (position 8853914)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9790762
GRCz11 4 9791678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGACATCATGGCAGCGTTCGGCGACAACTCCGAGCAGCAGCGAGTGTA[T/G]CAACAAGCTCAGGAGCAGATACACAAGATCTTGCATCCTGACGAGCACAC
Associated Phenotype:
Not determined