Busch Lab

ZMP

si:dkey-14o18.2

Ensembl ID:
ENSDARG00000062995
ZFIN ID:
ZDB-GENE-060503-145
Description:
Novel protein similar to vertebrate neuronal pentraxin I (NPTX1) [Source:UniProtKB/TrEMBL;Acc:Q1LUT9
Human Orthologue:
NPTX1
Human Description:
neuronal pentraxin I [Source:HGNC Symbol;Acc:7952]
Mouse Orthologue:
Nptx1
Mouse Description:
neuronal pentraxin 1 Gene [Source:MGI Symbol;Acc:MGI:107811]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5918 Nonsense Mutation detected in F1 DNA Not yet available
sa45661 Nonsense Mutation detected in F1 DNA Not yet available
sa11823 Nonsense Available for shipment Available now
sa23450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5918
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 334 722 2 5
ENSDART00000139727 Nonsense 155 416 2 5
Genomic Location (Zv9):
Chromosome 19 (position 10364123)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9822662
GRCz11 19 9741587
KASP Assay ID:
554-3835.1 (used for ordering genotyping assays)
KASP Sequence:
CGAGTTCATTGCGAGACCTCCTGCAACGCAAAATCAACACACTGGAAGAA[C/T]AGCTTCATCATCATTACGACAGTCACTACGGTCACTATGATCACCACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45661
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 346 722 2 5
ENSDART00000139727 Nonsense 167 416 2 5
Genomic Location (Zv9):
Chromosome 19 (position 10364085)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9822624
GRCz11 19 9741549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAAGAACAGCTTCATCATCATTACGACAGTCACTACGGTCACTA[T/A]GATCACCACGACCACGATTACCACCATACTGACCACCCCAGTAACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11823
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 572 722 3 5
ENSDART00000139727 Nonsense 266 416 3 5
Genomic Location (Zv9):
Chromosome 19 (position 10360726)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9819265
GRCz11 19 9738190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGCTCGGGTCCTGGCCTCGGAACCCCGTTCTCCTACTCTGTCCCTGGA[C/T]AAGCCAACGAGCTCGTCCTCAYTGAGTGGGGCAACAAWCCCATKGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23450
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091661 Nonsense 653 722 4 5
ENSDART00000139727 Nonsense 347 416 4 5
Genomic Location (Zv9):
Chromosome 19 (position 10357852)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9816391
GRCz11 19 9735316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCCTGGCATCCCATTAAACCAGGAGGAGTCTTCATTCTTGGCCAAGAG[C/T]AGGTATGGTCTTACTGAATCAAACTTAAAGCTTATACTTTTTAAGCATAT
Associated Phenotype:
Not determined