Busch Lab

ZMP

si:dkey-27b3.9

Ensembl ID:
ENSDARG00000062974
ZFIN ID:
ZDB-GENE-091118-70
Human Orthologue:
ITGA2
Human Description:
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) [Source:HGNC Symbol;Acc:6137]
Mouse Orthologue:
Itga2
Mouse Description:
integrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:96600]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41597 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8762 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa16899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41597
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Essential Splice Site 145 1167 4 28
ENSDART00000139466 Essential Splice Site 107 806 3 17
Genomic Location (Zv9):
Chromosome 10 (position 9003207)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9079163
GRCz11 10 8912722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAGCCCACAGTTTACCCTCCAGTCGGCTTTTTCCCCTGCTGTTCAAA[G/T]TACTAACACACATCTGTATCCTCTCTCTGAAAGTTTACTCTTCAGGTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3776
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Nonsense 528 1167 13 28
ENSDART00000139466 Nonsense 488 806 12 17
ENSDART00000091597 Nonsense 528 1167 13 28
ENSDART00000139466 Nonsense 488 806 12 17
Genomic Location (Zv9):
Chromosome 10 (position 9012669)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9088625
GRCz11 10 8922184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATNTTTTTAAAAGGGTATCTTGAGYAACCAGGGTTTCTTAGAGGGCTCA[C/T]AAAAGAACGCTCGGTTTGGGACRGCCATCGCTGCTGTCCCAGATCTYAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5580
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Nonsense 528 1167 13 28
ENSDART00000139466 Nonsense 488 806 12 17
ENSDART00000091597 Nonsense 528 1167 13 28
ENSDART00000139466 Nonsense 488 806 12 17
Genomic Location (Zv9):
Chromosome 10 (position 9012669)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9088625
GRCz11 10 8922184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATNTTTTTAAAAGGGTATCTTGAGYAACCAGGGTTTCTTAGAGGGCTCA[C/T]AAAAGAACGCTCGGTTTGGGACRGCCATCGCTGCTGTCCCAGATCTYAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Splice Site, Nonsense 581 1167 13 28
ENSDART00000139466 Splice Site, Nonsense 541 806 12 17
Genomic Location (Zv9):
Chromosome 10 (position 9012828)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9088784
GRCz11 10 8922343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATTTACATCTACTATGGYCACAGAAAAAGCATAAAAAAGCAGAGCTCA[C/T]AGGTAAAATGACACACTTGACAAACTCCTTAACACGCATTAAATATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16899
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Nonsense 1109 1167 27 28
ENSDART00000139466 None None 806 None 17
Genomic Location (Zv9):
Chromosome 10 (position 9030631)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9106587
GRCz11 10 8940146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAATAGCWATCATTGCCATCATACATGACAGGTTGAMGTCAAAGTTAGC[A/T]AACCTGGAGCTAAAGCAGAYGTTCCAGTGGGTGCCATTGTGGGAAGCATC
Associated Phenotype:
Not determined