Busch Lab

ZMP

ttll7

Ensembl ID:
ENSDARG00000062973
ZFIN ID:
ZDB-GENE-070112-2112
Description:
tubulin polyglutamylase TTLL7 [Source:RefSeq peptide;Acc:NP_001074064]
Human Orthologue:
TTLL7
Human Description:
tubulin tyrosine ligase-like family, member 7 [Source:HGNC Symbol;Acc:26242]
Mouse Orthologue:
Ttll7
Mouse Description:
tubulin tyrosine ligase-like family, member 7 Gene [Source:MGI Symbol;Acc:MGI:1918142]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38825 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35024 Nonsense Mutation detected in F1 DNA Not yet available
sa41784 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38825
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617 Essential Splice Site 457 505 None 13
ENSDART00000101561 Essential Splice Site 457 917 None 20
Genomic Location (Zv9):
Chromosome 11 (position 8192963)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8037066
GRCz11 11 8046905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATAATCAGATAAAACCCTTTTTTCTCCTCTCTCTCTTTCTCTCCATAC[A/T]GACGTATTTACCCCCCAGATGACAAGCTGCTCTTGGAGAAATATGAGAGT
Long Flanking Sequence:
CAAAGTATTATTTGTTGTTCCTAAAACTTGGATAGCGACAAGACTTTTGTCAGGTAGTGTCGAATAATAAGTCCACCATTAGTGAACAATACCTTCTGAAAATGTGTTTGTTTCAGTGTGACTGAAAATATGAATACATTCAAAGCACAATTTTGTGCCGTAGGGGGTCTCCGTCTGATGCCTTTTGTTCAACCTGGGGCTGAAGCAAAGCCAGTTGCTGGTTTTGATTATATACATGACCCAAAACGGAGCTGATCTGAAGATCCATCACTGAGATATAGGCAGATGTTTACACATCTTTGGCTTTTGTTTAGTCTTAACGTCTAATACAAAGACAAGTTTATTAATCATTAGAATATACACAGCATAAATGGACAAACGTATGTGTGAAAAGAACGATCGAGGTTTGTTTAAGTGATTAGAAAAGCAGGCAGACCAGGCTGCTAAATCAGATAATCAGATAAAACCCTTTTTTCTCCTCTCTCTCTTTCTCTCCATAC[A/T]GACGTATTTACCCCCCAGATGACAAGCTGCTCTTGGAGAAATATGAGAGTCTCCTTTCAGCTGCCTTTCAGACATTCCTCGCTGGGCGAGCAGCTTCACTTCAAAAGGAAATGAATAATCCACTGAAACGAATGAAGGCATGTACCTGAGACGCAACCCAACAATCTTTTGCTCTTTTTCCCCTCTTTCTCTCCCCTTTACTACAACTGCTTCCTACTATTTAATCTTTTGAATTTAAAATAAGAAATGTGGAAAAGAAACTATTTTGCTTCCTAACTCTTTTTGTGGCCATCTGTTTTTCTTTACCGCAGCTTAAGGCAGCCATCAGTAATACTGCTCATTCAAAGGGTTAGGGATTTAGACTAACCGTTTGTGCTACAGACATGAATGATACCTCAAATCATGTGGTTAGTTGAGGAGAGGTGTGCAATTACTTTTCAAAGCACTGATAGAATTTTTTTTTTCTGGCACTCAATACTGCTCACCCATTGACTGACAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27732
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617 None None 505 None 13
ENSDART00000101561 Nonsense 513 917 13 20
Genomic Location (Zv9):
Chromosome 11 (position 8164292)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8008395
GRCz11 11 8018234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGTTTGTTCTGCAGGAGGAAGATATTCTAGACCTTCTGGAACAGTG[T/A]GAACTTGACGATGAAAAACTGATGGGAAAAACCTCCAAACAGAAAGGACC
Long Flanking Sequence:
CTCTTAACCTAATAACTTGTCGAGCCACCATTAGCAGCAACAACTGCTATCAAGCTTTTTTAGCAACTTCTAATGGATCAGTTAAAGTGCTGTGGATGAATTTGAGCACACTCATCTTTGCGCAGAATTGTTGTAATTCAGCCACATTTTAGAGTAAAAACTGCCTTTTAAGGTCATTCCACAGCATCTCAATTTTGTATCTGCAAGTAGTTCTTGCCTGTTGTAAAGCTAAATGCGGTTCAATGATTTCAAATTAAATATATTTATGAATAAAGTTAAATCTAAGAAATGATTTTGTGAGTTTGGTTATTAAGCATTTGTCTAGGTGAAATTGCTGGTAACCTACAAGTTTAGCAGCCAAACAGATTTTTAAGTTAAATAATTTAAAAATATATAATAAAATAAATATTTCCAAACCATTTTATAGTGTATGTGAAAATGAAAACAATTACTGTGTTTGTTCTGCAGGAGGAAGATATTCTAGACCTTCTGGAACAGTG[T/A]GAACTTGACGATGAAAAACTGATGGGAAAAACCTCCAAACAGAAAGGACCCAAGGTATATGCAAATGTATATATGTACAGTAAACACGCAGGTTCTTCCTAACTAACCTTTCTAATTAATTCCCTTTTAACTATTTTAAAACAGAAGTTATCCATGAGGATTTCCAAACCATGATCGAAACCAAGCAGCTTACAAACTTGATCTAAACCAATGTTCTAAGATTCAATACAATTTAAACAGTTCTGTTCAAAGCAAGCCAGAGCAGTTCTTCCTAAAAATGCCAAGAAGAGCAGGATCTCTCAGAGTCTACAACACTGTTGGAGATTATATTCGAAGTGTTAATTTAGACAGACCTTTGAGCCAAATTGGAGTCGAAAAGGTGAAATCATTGTATACAGGAGGCTAATAGACAGTGCGTCCCAAGCGTTGGACAGATATTCAATCCGTTGCTCGATACTTCTTGAAGGACGTAATAGATTAGTTCCCCTGACGTGCATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35024
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617 None None 505 None 13
ENSDART00000101561 Nonsense 605 917 15 20
Genomic Location (Zv9):
Chromosome 11 (position 8158603)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8002706
GRCz11 11 8012545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTGGAAACCTGCCCCTAAACCAGTGCGGGGTCCTTCCTCCTCACCCTA[T/A]CTTTCTGGATTCATCCGCCGCTCTATGTCCTGTCCCCGCTCCATATCCTC
Long Flanking Sequence:
TGCGAGTGATCACCGGTGATTGGGTTTCTGCCAATCGGGGCATTAGGCCGTTCTGCGGTGACATTGTTTGCCCCCTTTGCCCCACACTACCCTGAGGCCATCTGCAATATTCCAAGCTAAGCTTCTATAATACCACATTTGGCAGGTTCTTCCCTCAAGATTCATGGATGAAGCAGCGATGCCTCTGGCCAGCTCACAAGCTGGAGGTCATTCAAAATCACAGATTTTGCTCGATGTGTGTTTCGGTTCACTGTTCGCCTTGAGTTTGGAAACTTGACAGCCACTCGGGCCTGCAGTATGATCACATGGTGGAGTGATTCATTAAAGCTTTTGGTTATTGGATTTGAAATGCTAGATTTAATATCCACAGCGATCCAGGAGAGGGTGTGGGAATGAATGTGCCTTAAATTGAAGTCAAATGCTCTGTTTTATTTTGTCTTAGGTCGTGTTCATTGGAAACCTGCCCCTAAACCAGTGCGGGGTCCTTCCTCCTCACCCTA[T/A]CTTTCTGGATTCATCCGCCGCTCTATGTCCTGTCCCCGCTCCATATCCTCTCTGACTGCGCAGTCACCTACCAACGAGACCAGGCAGCCAAAAACAGCCACTCAAATGGCCAACACGATGACTGCTGCAGCCACTCAAACTGCAGCCACCATGATGCAGATGACCCCAGTTCGACCCCACACAGCATCTCGTTCCCAGTCGCTCAGTCGCAACTGCTCTACAAATAGAGTTCCACACAGCAGCAGTCTAGGTGCCATTCACCCCAATTCGGCAAGTATTGAATCTGTCACACTGGAGCTATTTGAAAATGTGCGTTGATTACCTTGAGCCACCATCACACACTTCTCCTTAGAGCTCGACAGAACTGAACTGAGTTCCCATGTATGTTTGCTTACATCTCGAGGTAAAACAACCACAGAAGAAGTCATCTGAAAAGGGACATGACGTTTATATACAATGCATGTCAAACATTAAGTGACCATTACAATATCACAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41784
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617 None None 505 None 13
ENSDART00000101561 Nonsense 806 917 18 20
Genomic Location (Zv9):
Chromosome 11 (position 8147213)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7991316
GRCz11 11 8001155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTACGTCTGTATCGCCTCTTCAATCGTGTGTTTAACCGTCTGCTCTG[G/A]AGCCATGGTCAGGGGCTCTGGAACTGCCTCTCCACCTCTGGGTAAGAGAT
Long Flanking Sequence:
AAAATATTGCAATGTCTGATTTTTCCAATATCATGCAACCCTACCATTTCCGCCTTGTAATGCAAAACCCACACAAAGCATGGTGGGAACTACACCTTTTTTTAACCAGGTAGTTACACCAACACAAAACAATTAAATTAACTTTTACATATGTAAGTGGATTAAATGGAAATAAATAAAGTGTTCATTGTTTCAGCTTATTTTAAACAAGTGATTTAAACAAGCAGCAACAATCGTTTTTCTGAGTGTAGCCTACTTTTTTGAAGTGCTTAAAATCCCCATTTCTAGACATGAGTAGATTCTAGCTTTTTAAATTACAGTTTTTCCCCAACATACTCTTGTATTTTTAGTTATTTTTATCTATCTGATCCTTTTATGTAGGTTTTGGATATTGTCCGTACCAACATCCGCTCAGTTCTGCAGAGGATTTGGAGTGAACCAGATGTGGAGAGTCTACGTCTGTATCGCCTCTTCAATCGTGTGTTTAACCGTCTGCTCTG[G/A]AGCCATGGTCAGGGGCTCTGGAACTGCCTCTCCACCTCTGGGTAAGAGATTGAAATGATGATATCCTGAAGTCAATGTAAAACTGCCATTGCAATTACCTACAGCCAATGAGAGAGCAGCATCCACTAGTATGGGTATCTGCCAGCCAGCAGGAGGTTGGGAGAGAAGTGTAAAGGGCTTCTTTTAGGTCTACTTAGACCCAAGAAATGAATGAAAAGCAAGTGTAAATTTGGCAGGAGAACTTGTGTTTGTTTAACGTGTCATCTGAGGAATACCACAACCAGGGCGCAAAAGGAAAAGTTCAAGAGAAATTGCTAATTCCCTTCAAAGCCCAGATGAGCAAAATAAGTACAATTTCTACCCCACTTAAATAATAACAAAAAATATACTACATGACCTTGTGTTGTTGCCATGTCATTTTTCGCGCATTTGTGGCTGCAAGATGTAGTTTGCGGACCAAGATACAGTTGTCAGTGATTTTTCCTTTTGTAAAGACATTC
Associated Phenotype:
Not determined