Busch Lab

ZMP

mll4a

Ensembl ID:
ENSDARG00000062962
ZFIN ID:
ZDB-GENE-060503-376
Description:
Novel protein similar to vertebrate myeloid/lymphoid or mixed-lineage leukemia (Trithorax homolog, D
Human Orthologue:
AD000671.3
Human Description:
Histone-lysine N-methyltransferase MLL4 [Source:UniProtKB/Swiss-Prot;Acc:Q9UMN6]
Mouse Orthologue:
Wbp7
Mouse Description:
WW domain binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:109565]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa30709 Nonsense Mutation detected in F1 DNA Not yet available
sa43228 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23447 Nonsense Available for shipment Available now
sa15376 Nonsense Available for shipment Available now
sa36784 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23448 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1679
Status:
KASP failed
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 118 2863 2 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Essential Splice Site 126 801 2 7
Genomic Location (Zv9):
Chromosome 19 (position 9862570)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9321109
GRCz11 19 9240034
KASP Assay ID:
554-1625.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTTTAATGTGGACGGTCAGTSGTCCTTGCGTTCTGGGAAAAGTTCAAG[T/A]AAGTATTTTGTTTATTTATTTATATATTTATTTGCTGTTAATGGAAATAA
Long Flanking Sequence:
GCTTGGCAAGTGAGAAAAAGAAAACCTAACAGCAATGCGTTAAGTCTATTATATTCGTTTAGTACATAAAGTCTTACTGCTCAGTCAAGTAGAAAGATGGAGCAGGGATGTAACATACAGAACTGTTGTATTTGAAGCCGTATAATGCATTGAAATGGTTGCTTTTATTGAATATTTGTTGTTTTGTATAATGCCAGAGCTATTAATGAACAGGGCTATTAATGTAGTGCTGCTATTTCATTTTGATATTTATTCATCGGGTAGTTGTAGAACGGGCTAAAAACACTTATAGGGCTGCTGTAATTTTAGCCAGTGCAGACAAAACAGCAAACGTCAAAGTCTCTTAAAAATGTTATCATATTTTTAAGGGATTATACATTCAAGGTGCACTTGTAGATCTCTGGTGTTATATTTTAATCAATCTTTCTTTCTCAGGAGGGAGATTTCACTGGCTTTAATGTGGACGGTCAGTGGTCCTTGCGTTCTGGGAAAAGTTCAAG[T/A]AAGTATTTTGTTTATTTATTTATATATTTATTTGCTGTTAATGGAAATAAATCTGCTTTTTAAATATTCAACATTACCTTTTCGTACTCTATTAATCAAGTATTTGACAAATTCATTTCAGATTTAACATTCTCTTGTGTTGTTTAGGGTTATTTTGTGTTTATTATGAATAATCGAATGCTTTAATACTTTTCATCCCTCTCTTTTATACAGACCGTGCCCTTAAATTGGCATCATCAAAGGTGAAGCGCTCCTCAGCAGCAGATTTAAAATCATCAATATTGAAAAAACCTGGCATGAGAGGCAGACCCTTTTCCAGAACTGACCAAAAATCTGTAAGGCCCAAAATGGTAGTTAAAGTGGCAGCCAAAAGGGTGACCAAAAGAGAAACAAAAAAGCCATCTGTAAATGGAGATGGACATTTAAAACAGGGCAGCTCAAGCAAGACAAATGGCAGGGTACTCAGGAACCAGAGAGAGGGAACAAGGGTCTCGTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30709
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 269 2863 3 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Nonsense 277 801 3 7
Genomic Location (Zv9):
Chromosome 19 (position 9863238)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9321777
GRCz11 19 9240702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAGCCTCCAAACTTAAAGACACCCAAGGCCAAAGAGCTTCAGCAGACTA[T/A]ACCAAGAGGGTCAAGACAAAAGGAGTCACCGCTGGTGATGAGGCAGAGGA
Long Flanking Sequence:
GAATAATCGAATGCTTTAATACTTTTCATCCCTCTCTTTTATACAGACCGTGCCCTTAAATTGGCATCATCAAAGGTGAAGCGCTCCTCAGCAGCAGATTTAAAATCATCAATATTGAAAAAACCTGGCATGAGAGGCAGACCCTTTTCCAGAACTGACCAAAAATCTGTAAGGCCCAAAATGGTAGTTAAAGTGGCAGCCAAAAGGGTGACCAAAAGAGAAACAAAAAAGCCATCTGTAAATGGAGATGGACATTTAAAACAGGGCAGCTCAAGCAAGACAAATGGCAGGGTACTCAGGAACCAGAGAGAGGGAACAAGGGTCTCGTCACTGACGGAAAATGATAAAACTACAGTGGATGAGGATGATACCAATGTAAAGTCACAGACGCATGGTTCCAGTGCTGCGGAGAAATTAGTGTGGACTTTGACACTGGTTAAAGGTAAAGAGCGAGCCTCCAAACTTAAAGACACCCAAGGCCAAAGAGCTTCAGCAGACTA[T/A]ACCAAGAGGGTCAAGACAAAAGGAGTCACCGCTGGTGATGAGGCAGAGGAGGTTTCCGCAAAACCAATGGCCAAACAGAAAAGGGGCAGAAAATCTGCAGCAGACAAATTGGCTCTTAAATCTCCTGGCACAGATGTTGGAGCATCTTTAAGTGACAGAGTGTTAATTTCTTCCCAAAGGAAGCCTTTCGTAAGGCGACGAAAGCGCGGCCAGCGAAGGTTACTGCTAAAGAAAGTTCACCGCAAAGTACCTGACAGTCAGAGGCAGGCCTCTAGTATGCCTAGAAAGAGACAAAGACTTTCTGTCTCAGATACAGACCCTATAAATGTTCTACAGCCGGTGGAGGGACAAGAACAAGCACTCCTGGAGTCCACCTCTGGAGGCCAAGCTGAAGAGCTGAAACATCCCACCAAACCTACTGTAAGCGCTCGTTCTTCACGTGTCATCAAGATCCCAAAGAGGTTCATGGATGACGAGCGAATGTCTGCTCTTCCAGAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1255
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 386 2863 3 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Nonsense 394 801 3 7
Genomic Location (Zv9):
Chromosome 19 (position 9863587)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9322126
GRCz11 19 9241051
KASP Assay ID:
554-1170.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCTGTCTCAGATACAGACCCTATAAATGTTCTACAGCCGGTGGAGGGA[C/T]AAGAACAAGCACTCCTGGAGTCCACCTCTGGAGGCCAAGCTGAAGAGCTG
Long Flanking Sequence:
CTACAGTGGATGAGGATGATACCAATGTAAAGTCACAGACGCATGGTTCCAGTGCTGCGGAGAAATTAGTGTGGACTTTGACACTGGTTAAAGGTAAAGAGCGAGCCTCCAAACTTAAAGACACCCAAGGCCAAAGAGCTTCAGCAGACTATACCAAGAGGGTCAAGACAAAAGGAGTCACCGCTGGTGATGAGGCAGAGGAGGTTTCCGCAAAACCAATGGCCAAACAGAAAAGGGGCAGAAAATCTGCAGCAGACAAATTGGCTCTTAAATCTCCTGGCACAGATGTTGGAGCATCTTTAAGTGACAGAGTGTTAATTTCTTCCCAAAGGAAGCCTTTCGTAAGGCGACGAAAGCGCGGCCAGCGAAGGTTACTGCTAAAGAAAGTTCACCGCAAAGTACCTGACAGTCAGAGGCAGGCCTCTAGTATGCCTAGAAAGAGACAAAGACTTTCTGTCTCAGATACAGACCCTATAAATGTTCTACAGCCGGTGGAGGGA[C/T]AAGAACAAGCACTCCTGGAGTCCACCTCTGGAGGCCAAGCTGAAGAGCTGAAACATCCCACCAAACCTACTGTAAGCGCTCGTTCTTCACGTGTCATCAAGATCCCAAAGAGGTTCATGGATGACGAGCGAATGTCTGCTCTTCCAGAAAGAGCTGCTCTAAAGAAACCAGCTCTTACCGAGCTCCCGACAGATCTCAGCAAACCTAATACTGATCATCAAACGCTTGAATCTGGCAGCAGGCTGAAGACCACGCAAGAACTGGACATCGTAAATGACGATGAAAAAAGTGTTTTAGAAAAAATGCAATCTCAAGGAGTCAAACCTGCTCTGAGCTCTTCGAGGCTCTCTGGAGGAGCTCGAGGAAGAGGTGGGAGAATCGGCCAATCAGCAGACCACTATAAAATATACTGGAAGCTGAAGAAGCTCACGGCCTGCCTGGCCAAACGAAAGATGCAGCGGATGGCTGGTGATAGTTCCAGACTAACAGAGGAAGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43228
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 605 2863 3 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Essential Splice Site 613 801 3 7
Genomic Location (Zv9):
Chromosome 19 (position 9864246)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9322785
GRCz11 19 9241710
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCAGACACCGCTTGCTTCTTTAGCGGAAGCCTCTTCTAAGGAGAATGG[T/A]AAGGTTTTTGCTGTCAAACTTGTAGAGCACTTTTATAGTAGAAATGCAGC
Long Flanking Sequence:
CTAAAGAAACCAGCTCTTACCGAGCTCCCGACAGATCTCAGCAAACCTAATACTGATCATCAAACGCTTGAATCTGGCAGCAGGCTGAAGACCACGCAAGAACTGGACATCGTAAATGACGATGAAAAAAGTGTTTTAGAAAAAATGCAATCTCAAGGAGTCAAACCTGCTCTGAGCTCTTCGAGGCTCTCTGGAGGAGCTCGAGGAAGAGGTGGGAGAATCGGCCAATCAGCAGACCACTATAAAATATACTGGAAGCTGAAGAAGCTCACGGCCTGCCTGGCCAAACGAAAGATGCAGCGGATGGCTGGTGATAGTTCCAGACTAACAGAGGAAGATGCTGAGGAAGGGACCCAGGGTACTCGAGAACAAAAGTCTGATCTGAAACTGCAGGACATCTATTCTCCGGGAGTGGTGCCAAAAGTAGCCATACGTGTTGGGGATCATTCAGATCAGACACCGCTTGCTTCTTTAGCGGAAGCCTCTTCTAAGGAGAATGG[T/A]AAGGTTTTTGCTGTCAAACTTGTAGAGCACTTTTATAGTAGAAATGCAGCTCTGAGTGCTTTGAAGTTAAAAAGAAAAATGTAGTTAACGTTACACCAAGTATTTCACATAAAATGTCATAGTTATTATAACACAAAATACAGTAAATGTTATTATATTCTATAGCATAGTTACTAGGGATGTAATGATTCACCGTGAGCCAGTTGACAATCGATTGAAATATGCGACAATAAAAACCAGTTCAAATCTTGAATCAATCGCAATACATGTTTTGAACAGAGGGGGCGCTGTTTAGAGATGCAAACTCGCTTTACCTGCACATCAGCAGCAAGTAGGTCTGTGTATTGGCAAGGGCCTCACGATATGATACATATCACGATACATGGGTCACGATTCAGTATATCACGATATATTACGATACAACAAATATTGTGATATATTGCAATAGTTTGTATTAGTATGTGTGTCATGTTATATAGACAACTTGATCAAGTCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23447
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 629 2863 4 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Nonsense 637 801 4 7
Genomic Location (Zv9):
Chromosome 19 (position 9867092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9325631
GRCz11 19 9244556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCACTGAAACAAGTGCACAAAATGAGCAGCAAGGTGGTATCCCGCAG[C/T]GAATGAGTGTTTCCGGAGCCAATAGGAGGATGATCCACTTGTTGAAGAGA
Long Flanking Sequence:
TAATCTATATGCCTCTAAACATACTTTGCACAAGAATGATGTCTTAGTTTTCAAAGACATTCCTTTTTTTTTTATGTTTACATGAACACAACAATGGCGGCATTTTCAAAAATGTCTATACATGTTTATAAATTTATGCATATTCAGTCCAAAAATGACGTCATGTTGTAAACGAACCGGCAAAACGTATAAATAATTTACCATATTTGGCTGGAAAAAATGTTGTGTACACGCCCTCTTAATCTAGTCATTTTAAGAATACAACACTTTATTGTTGGCTTATGTTTATTAAAACTATTAGCAGATACTGTACTAACTGTTAAAATATTCATATATTAAATAACAACATCAAATTATTTCCTAAGTATGTCTTCTTTCCAAATGTGTTCTGTTCTCTTATTTGCTTAACATTAAGACCCTTTTTTTCAGTAGAGACGGATAATCTCGAGGACTCCACTGAAACAAGTGCACAAAATGAGCAGCAAGGTGGTATCCCGCAG[C/T]GAATGAGTGTTTCCGGAGCCAATAGGAGGATGATCCACTTGTTGAAGAGAGCCAGAGTTCAACTCATTAAAATTGACCAACAAAAGCAGCTCAAATCAGCTCAGGTCAGAAGGTTTAATGTTTCGGTGACTGAAATGTATGTTTTATTGAGTTTTGTCCAGTAATCTTCAACCAAAGCAAAAAAGATAACTAAAAAGAGTTTCATGTTTGAATATAAAAATGAAGGAATATATTTAGACCATTAAAATGAGCAAAAGGCTGTTCAAATAAATACAATTTTAACAATAATAAAAAACATCAAAATATATTAGAATTAAAATATATATTTGAAATTGTAATCAAATTTCACAAGATTGCATTTTATTCTGATTTTATTCCGGTGGAAAAAAAGACTTGAAATACAAAACTAGTTTTATTTAAAATTAATTTTTGTTATTCTTGGATATCATCTTGTGCATTTTTGTACATGTGGGTGTTCTTTAAATTATAATAGAGATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7876
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 664 2863 5 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Essential Splice Site 672 801 5 7
Genomic Location (Zv9):
Chromosome 19 (position 9868203)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9326742
GRCz11 19 9245667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTGCCACGTGRCTGTGTTGTTATACTTATGACGGTGATTATTCTGTGC[A/T]GCTTCTGTCTGGCWCTGTAAAAGCAAGAGAAGGACCAGCCACAGCTGGGC
Long Flanking Sequence:
AAACTCAAAACGTTGGTCTGAGTGACAATAGTTTATTAATTCTTTAAATAAATGCAAAACTGACAGAAACGAGAATAGCTGATGGATTATACACTAACTTGCACATTATTTAGTCACAAGATGGCACCAAACAGTCAAAAACGCAAAGCTGACAGACATAAAACTGGCTGAATTAAACAAATACTAGCCTATGTATTATTAATTCTCAAGATGGTGTAAAAAATGTCTGACAAACAAGCAGATAAATGTGAATGTGTATGTAGGTATATGGATTTGAATGCATTCACTGATGGTCAAAGTGATTCAAAGTTCCCAGATGAGCCTGTGCTATTTAGCGGTTGTTATCTTGGGATAACATACTTTGGAATGTCACTACTGACCAATCAGATTTGAGTATTCAAGACAGCTGAGTAATACATTTTGCTAAATATGTTGATGTAATATCTTTTATAGTGCCACGTGACTGTGTTGTTATACTTATGACGGTGATTATTCTGTGC[A/T]GCTTCTGTCTGGCACTGTAAAAGCAAGAGAAGGACCAGCCACAGCTGGGCGCAGAGGCAGAAAGAAGGGCACGAGAAAAGTTCGAGCCAACCCAGAAGTGGCTCCACAGGTAAAGATAATACAAATGACTCCTCTGCAAGTTTTTTCATTGGTTTCCGAGTTCAACATTGTGCCCTTTTACCTCCGTAGGCACAATTGATCGGTGGTCCACGTATAAAGCATGTGTGTCGAGCAGCAGCTGTGGCTCTAGGACAGCCCCGCGCACTGGTCCCCGATGACATTCCCAGACTCAGCGCCCTTCCTCTGCACGAGAGAGAGGGCATCACTGCTTCACCTGTGGAAGAGGGTACACACCTCTCCTTTCCTCATTCTGTCCGCATCCATTATAAGTGACGTTTTCTAATGTCTTGGAGCTCTTCTGACCTGTAAATGTGTATTTTGTTTGTTAGTCGACTCGACTTGTAATACACCTAGTAATTTGTTTACTGTGGACTTGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15376
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 1017 2863 12 37
ENSDART00000136957 Nonsense 57 1897 2 27
ENSDART00000147922 None None 801 None 7
Genomic Location (Zv9):
Chromosome 19 (position 9873986)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9332525
GRCz11 19 9251450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGGCTTGAGTATTCTCACTTCAGTTCCCATCATGCCCCAGTGTGTTTG[T/A]CTGCTCTGTGCCAGCAAAGGCCAGCATGAGGTAAGATKCAACACYMTTGA
Long Flanking Sequence:
TCCATCAAAGAAGACCAAACGCAGGCTGCAGTTGCGGCTGAAGCGGCTGCCGGCCAGTGTTGTGCAAGCGGCCATGCTGGGCTTGACTTTACCACAGAGCGAGTCACAGAGAGTGCTGTGTGAGGAGCCAGTTTTCACTCATTGCTCCTCTGTTACTCATTCTCAGAGTTCGGTCGAGCACACGCCGTCCAGCGTCCTCACTCCACTGTCCAACGGCTGCACGCAGAGGGGAAAGTTGTCACAGGGGTCAATGAACAAGATTCGGGTGGACTTTAAGGTCAGGCATCTTATTTATACTTTACAATATATATATACATAAAAAATGTTGTAAATATAACGAAAACGTTTTGAATTCCTTAATGTGACTTAAAGAAAAATTATATTCGGTTTTACTTAATGTTTTTATGAATGATGCAGGAGGACTGCAATATCCAGAATGTGTGGTTGATGGGAGGCTTGAGTATTCTCACTTCAGTTCCCATCATGCCCCAGTGTGTTTG[T/A]CTGCTCTGTGCCAGCAAAGGCCAGCATGAGGTAAGATTCAACACTATTGAATCTTTAGCCATATTCCTTCATTTTAGTTCACAGAACTAGTGTTGTCAGGATACTGGAATTTGGTACCAATTGGTGAAATTTAAAAATGTTCAGCTAACTTTTGAGCGCTGTTTGCATGTTCTTAAACAGCACTAGTTTGCCGTTGTGTTCATGTGCCAAAATGACTGTGATTGGCCGTGAAGTTCGTCAGTTCACCAAACCCGCCACTGTTTAATGAGTGTAACCACAGATAGACGGACACTAAAGTGTTTTACAAACACAAGATGAGAGACAATAATTATCCTTTATATAAGGATGGAGCAGTTGATCGAATAATACATGTATATACTGTAATGTCATTGTTGAATGTCTAGTTACTTTTCGTTCACCTTGTAAATAGCATATCTAATTATATGTAATGTTTTTTATACATGTTTATAAGACCCTGGATGTACGAATGAGCATTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36784
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 1027 2863 12 37
ENSDART00000136957 Essential Splice Site 67 1897 2 27
ENSDART00000147922 None None 801 None 7
Genomic Location (Zv9):
Chromosome 19 (position 9874018)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9332557
GRCz11 19 9251482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCCCCAGTGTGTTTGTCTGCTCTGTGCCAGCAAAGGCCAGCATGAGG[T/A]AAGATTCAACACTATTGAATCTTTAGCCATATTCCTTCATTTTAGTTCAC
Long Flanking Sequence:
TGCGGCTGAAGCGGCTGCCGGCCAGTGTTGTGCAAGCGGCCATGCTGGGCTTGACTTTACCACAGAGCGAGTCACAGAGAGTGCTGTGTGAGGAGCCAGTTTTCACTCATTGCTCCTCTGTTACTCATTCTCAGAGTTCGGTCGAGCACACGCCGTCCAGCGTCCTCACTCCACTGTCCAACGGCTGCACGCAGAGGGGAAAGTTGTCACAGGGGTCAATGAACAAGATTCGGGTGGACTTTAAGGTCAGGCATCTTATTTATACTTTACAATATATATATACATAAAAAATGTTGTAAATATAACGAAAACGTTTTGAATTCCTTAATGTGACTTAAAGAAAAATTATATTCGGTTTTACTTAATGTTTTTATGAATGATGCAGGAGGACTGCAATATCCAGAATGTGTGGTTGATGGGAGGCTTGAGTATTCTCACTTCAGTTCCCATCATGCCCCAGTGTGTTTGTCTGCTCTGTGCCAGCAAAGGCCAGCATGAGG[T/A]AAGATTCAACACTATTGAATCTTTAGCCATATTCCTTCATTTTAGTTCACAGAACTAGTGTTGTCAGGATACTGGAATTTGGTACCAATTGGTGAAATTTAAAAATGTTCAGCTAACTTTTGAGCGCTGTTTGCATGTTCTTAAACAGCACTAGTTTGCCGTTGTGTTCATGTGCCAAAATGACTGTGATTGGCCGTGAAGTTCGTCAGTTCACCAAACCCGCCACTGTTTAATGAGTGTAACCACAGATAGACGGACACTAAAGTGTTTTACAAACACAAGATGAGAGACAATAATTATCCTTTATATAAGGATGGAGCAGTTGATCGAATAATACATGTATATACTGTAATGTCATTGTTGAATGTCTAGTTACTTTTCGTTCACCTTGTAAATAGCATATCTAATTATATGTAATGTTTTTTATACATGTTTATAAGACCCTGGATGTACGAATGAGCATTTTGAAACAAAAACATTTTTGTACAAATGAAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 1343 2863 20 37
ENSDART00000136957 Essential Splice Site 382 1897 10 27
ENSDART00000147922 None None 801 None 7
Genomic Location (Zv9):
Chromosome 19 (position 9878488)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9337027
GRCz11 19 9255952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCCAGGACCCCAAAACCTGGAGCTCAAATGTGCAAGAATTCCCACGG[T/C]ATGAACCACATTTTTCTTACTTTTCAATAATAAGGTATTCTTAGTCAAAC
Long Flanking Sequence:
TTACTGTATCCATTGTATAGTACTGTTTTCCCCCAACATTCAGTATATCTTTGTGTTCAACAGAAGAAACTTTTAAAATGACAAATTTTGGGCGAACTATCCCTTTAAGTGAAAAGTCATCAGTTTCATTGTGAAATACTTTAATACTTATATTTTTAAGCAATGGTATAAATCAGAAACCATGTGTTCTCTCTCATTTTAGAAATCATTTCATGAGGATGTGGTCAAGGTGATGGTGGAAAGACTAAGAAGAGAAGAATATCTTCTAGAGGCACAAAGGCCCACAAGCCAAGCCAAACTGTATTACATTAAGGTGATGTGTCTTATTTACAGCTACAGTAGCTACTGGAATATTTGAATGCAGTGCTTATGGCATAGTGATGTTTACAGGTAGCTAATTTTCAGTGTTGTTGTTTTCACAGCTAGTAGAACAAGTGTTTAGCTGGTTCAACAGCCAGGACCCCAAAACCTGGAGCTCAAATGTGCAAGAATTCCCACGG[T/C]ATGAACCACATTTTTCTTACTTTTCAATAATAAGGTATTCTTAGTCAAACAAATGCTCTGCAGACTGCAGATTAGCCTATTAATTAATACTGAGTCATACCTTACACCAGGGCTTCTCAAAGGCCCCATTCCCAATTCTACACCTTAGCCCTTCCCCTTACCACTACCCCTCGTTTTGCACGTTCCCGTGAAGGGGGAGGAGTATCCTAATTCTAGCTTGAAAGCATAGGTCTAAGGGGAAGGGGTGAATAGCCCTTTGTTTTTCAGGAACACACTCAAAACCTAGGGGTAAGAAAATTTCATCATACATCAACCACAACATCAAGATCGCAGCACCCGGAAGTAAGGAGATCCACAAATTAGTATTTTTTTGTCATTTTTACGAATATTTACAACAAACAAACACGCTTTAATATATTCATAACTGCGTTCGTGTTTTACCATCATGATTAAAAAAAAAAAGCCTAAAATAAAAACCGCTAAATTTTGCGATCTATAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4788
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 2429 2863 29 37
ENSDART00000136957 Nonsense 1463 1897 19 27
ENSDART00000147922 None None 801 None 7
Genomic Location (Zv9):
Chromosome 19 (position 9889571)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9348110
GRCz11 19 9267035
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCATCAACTCTTCGTACTCAACCCAACATCTTGGCCAACTCTCGATCT[C/T]AAGTCAGAATCAAGAGAGTGTCCTCGGTAACTGAACGAATCGGTGTGAAA
Long Flanking Sequence:
AGATTCTAGTGAAAAACCCGCAGAATAATACATACCAAATACCTAGTGCAAATTCCCCCTCGTATACACAAATAAGCCAGATTGCAAGAATAATACACGGCAGTAATGTCCTCCAGCGGCCTGTTCCTAAAGTCACAGTAATGCCAGTGCCGCAGCTTCAGGCTTGTCTTAGTAGAACGTCACCAGCGCGTATCATATCTTACAGTAGCAACAGTGGAGCAGCACCACCTACCCAGGTGCTAATCAGGAGGATTCCTCAGAGTTTTCCTGGTGGCCAATTGTCCGGTGTAAGCCCACCACTAGAAAAAGCTGGCTCAATATCTGAAGGTGGACAGAAAGAGCTGGCCCAGGTCATAATTGACAAAGCAATGGCAAGTCACCGTGAAGTGGCAAATGCCACCACTGCGAGTCCTTCTCTTCTCGGTAAACGCCTCTCTCCTGAATCAAAGAAATCATCAACTCTTCGTACTCAACCCAACATCTTGGCCAACTCTCGATCT[C/T]AAGTCAGAATCAAGAGAGTGTCCTCGGTAACTGAACGAATCGGTGTGAAAAGATGCAAGACAGACTTCTTGGATCAGATGGCTCCTAGTTCCCAGGATGACCACAGCAGGTATGGTCAAAAATTGTATCAAATTTCCCACAATTGTACATTCCAGGGGTTTAATCCTGGTTCCTGGAAGGCCAAGGTCCTACAGGGTTTAGTTCTAACCTTACTCCAACACACATTCCTGTAGTTTTCAAATACGTTTGCTAAACTTGATTAGCTTGATCAGGTGTTTTAATTAGTGAAGCTTAAAGGCTGGTTTATACTTCTGCGTCGAATGATCGGCGTGACCCACAACGCCTGCCTTTCGAGTTGCTGTGCATTTATACTTCTGCGTGCTTTTTTTGTTGCTTTGCAATAACACTTCTAAAACGCTAGCTGGCAGTAAGTCTTTTTAGTTCCTCTGTGTCAAGTTTCTTCATGAGTGTTTTGTTTTTTCTGTAAGCTACTGTAATGT
Associated Phenotype:
Not determined