Busch Lab

ZMP

fam69a

Ensembl ID:
ENSDARG00000062955
ZFIN ID:
ZDB-GENE-060421-4286
Description:
Protein FAM69A [Source:UniProtKB/Swiss-Prot;Acc:Q1RLQ5]
Human Orthologue:
FAM69A
Human Description:
family with sequence similarity 69, member A [Source:HGNC Symbol;Acc:32213]
Mouse Orthologue:
Fam69a
Mouse Description:
family with sequence similarity 69, member A Gene [Source:MGI Symbol;Acc:MGI:1914516]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19687 Nonsense Available for shipment Available now
sa18374 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2073
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Essential Splice Site 18 428 1 5
ENSDART00000137840 None 18 18 1 1
Genomic Location (Zv9):
Chromosome 2 (position 10433738)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10858834
GRCz11 2 10642433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGGGTCTGTTTTCACGGGCCTGGCTGTCAAAGACGCACCATTTTCAGG[T/A]AACAATCTGGCAAATTAATCTGCATTTCATGACGTTTGGATACCATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19687
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Nonsense 260 428 5 5
ENSDART00000137840 None None 18 None 1
Genomic Location (Zv9):
Chromosome 2 (position 10476533)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10901629
GRCz11 2 10685228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTATGGATCTGTGGATCCCCGCGGGAATGCGGCGAAGCATGGACCAGTG[G/A]TTCACACCGTCCTGGCCCCGCAAGGCCAAAATCTTCATCGGCTTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18374
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Nonsense 268 428 5 5
ENSDART00000137840 None None 18 None 1
Genomic Location (Zv9):
Chromosome 2 (position 10476555)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10901651
GRCz11 2 10685250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGAATGCGGCGAAGCATGGACCAGTGGTTCACACCGTCCTGGCCCCGC[A/T]AGGCCAAAATCTTCATCGGCTTGCTGGAACTTATTGAAGACATCTTCCAT
Associated Phenotype:
Not determined