Busch Lab

ZMP

si:ch211-260p9.1

Ensembl ID:
ENSDARG00000062933
ZFIN ID:
ZDB-GENE-050419-50
Description:
Novel protein similar to human c-Maf-inducing protein (CMIP) [Source:UniProtKB/TrEMBL;Acc:Q1LWW3]
Human Orthologue:
AC099480.1
Human Description:
C-Maf-inducing protein [Source:UniProtKB/Swiss-Prot;Acc:Q8IY22]
Mouse Orthologue:
4933407C03Rik
Mouse Description:
RIKEN cDNA 4933407C03 gene Gene [Source:MGI Symbol;Acc:MGI:1921690]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36594 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43067 Nonsense Mutation detected in F1 DNA Not yet available
sa32192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36594
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Essential Splice Site 127 679 4 20
Genomic Location (Zv9):
Chromosome 18 (position 12830342)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13385154
GRCz11 18 13353666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCAGAACACTAACCTCAGCGCTCAGGACCACGAAAACATCATTGTGG[T/G]GAGTAGGGCTGCTTTTAGTTTTTTTTTTTTTTGTAACTTAGAAAATATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28998
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Essential Splice Site 148 679 5 20
Genomic Location (Zv9):
Chromosome 18 (position 12829967)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13384779
GRCz11 18 13353291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGAATAACCACCCTCCCCCTGACCTGTGCGAATTCTTCTGCAAGG[T/C]AAATACAAGTGTTCATAATTATTATTACTATTAGTTTTATTTAACAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43067
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Nonsense 192 679 7 20
Genomic Location (Zv9):
Chromosome 18 (position 12827688)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13382500
GRCz11 18 13351012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTTCGGGAAATGCCCCAGACTCCGTCTCTTTACTCAGGAGTATATTT[T/A]AGCTCTGAATGAGCTTAACGCCGGCATGGAAGTGGTCAAGAAGTTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32192
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Nonsense 240 679 8 20
Genomic Location (Zv9):
Chromosome 18 (position 12824327)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13379139
GRCz11 18 13347651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCCCAAATCTCGTAGCGGTTTGCCTGGCTGCCATCTACTCCTGCTAC[G/T]AAGAGTTCATCAACAGGTGCGTCCGATTCTCTGTTTACCCCATGTGTTTA
Associated Phenotype:
Not determined