Busch Lab

ZMP

si:dkey-220f10.4

Ensembl ID:
ENSDARG00000062902
ZFIN ID:
ZDB-GENE-030131-9651
Description:
Novel tub family member protein [Source:UniProtKB/TrEMBL;Acc:Q1L8C0]
Human Orthologue:
TULP2
Human Description:
tubby like protein 2 [Source:HGNC Symbol;Acc:12424]
Mouse Orthologue:
Tulp2
Mouse Description:
tubby-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:1861600]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35277 Nonsense Mutation detected in F1 DNA Not yet available
sa35278 Nonsense Mutation detected in F1 DNA Not yet available
sa14354 Essential Splice Site Available for shipment Available now
sa1568 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa35277
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084007 Nonsense 58 556 3 13
ENSDART00000091452 Nonsense 76 503 3 17
ENSDART00000128160 Nonsense 76 456 3 14

The following transcripts of ENSDARG00000062902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 21971511)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20497092
GRCz11 12 20618966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACACGCAAACAGAAACCTGAGTGTGACGATACTGTTTTATTGATAAGC[C/T]AATCTCAAAGCAATACTTCCCTCAATGGTTTGTACACACTTACACTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35278
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084007 Nonsense 60 556 3 13
ENSDART00000091452 Nonsense 78 503 3 17
ENSDART00000128160 Nonsense 78 456 3 14

The following transcripts of ENSDARG00000062902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 21971517)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20497098
GRCz11 12 20618972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAACAGAAACCTGAGTGTGACGATACTGTTTTATTGATAAGCCAATCT[C/T]AAAGCAATACTTCCCTCAATGGTTTGTACACACTTACACTATATAAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084007 Essential Splice Site 187 556 None 13
ENSDART00000091452 Essential Splice Site 146 503 None 17
ENSDART00000128160 Essential Splice Site 99 456 None 14

The following transcripts of ENSDARG00000062902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 21973198)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20498779
GRCz11 12 20620653
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAAGACAAATGGAACTAAAGGGAGAGCAAAGACAGGGGAACAGTCCTG[T/A]AAGTTTACCGGAGATGTGTGTCTATTGTTAGGCTTGACACAAGTTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1568
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084007 Nonsense 279 556 7 13
ENSDART00000091452 Nonsense 214 503 10 17
ENSDART00000128160 Nonsense 167 456 7 14

The following transcripts of ENSDARG00000062902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 21973687)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20499268
GRCz11 12 20621142
KASP Assay ID:
554-1511.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAAAACACAAAAAGTGTTAACAGTCTTGCCTCTTTGAACTCCAACTA[T/G]AAGGAGCACTCTTCTGACAGTGATTCTTCCGACATCGGAAAAGTGAGTAT
Associated Phenotype:
Not determined