Busch Lab

ZMP

si:dkey-103i16.6

Ensembl ID:
ENSDARG00000062893
ZFIN ID:
ZDB-GENE-061207-46
Description:
hypothetical protein LOC557125 [Source:RefSeq peptide;Acc:NP_001038173]
Human Orthologue:
SIRT3
Human Description:
sirtuin 3 [Source:HGNC Symbol;Acc:14931]
Mouse Orthologue:
Sirt3
Mouse Description:
sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) Gene [Source:MGI

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23259 Nonsense Available for shipment Available now
sa36601 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23260 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099777 Nonsense 93 370 2 6
Genomic Location (Zv9):
Chromosome 18 (position 14871210)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15316628
GRCz11 18 15285140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCGCGGGGCTTTGGAAACCATCGGCAGGCTGATGAAGCTTGGTCGAGTG[C/T]GAAACATTGTGGTAGTTGCTGGAGCAGGAATCAGCACAGCCAGCGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36601
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099777 Essential Splice Site 113 370 2 6
Genomic Location (Zv9):
Chromosome 18 (position 14871273)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15316691
GRCz11 18 15285203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTTGCTGGAGCAGGAATCAGCACAGCCAGCGGGATCCCAGACTTCAGG[T/C]GAACACACACACAAAACCACAAACCTTCAGACTGCTGCTAAAATCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099777 Essential Splice Site 190 370 3 6
Genomic Location (Zv9):
Chromosome 18 (position 14871589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15317007
GRCz11 18 15285519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCTGCTGCTCCGCATGTACACCCAGAACATCGACGGTCTCGAAAAAC[G/T]TGAGCTTAAATGGACAGTTCAGATAAAAATAAAATAATTGTCGTTTACTC
Associated Phenotype:
Not determined