Busch Lab

ZMP

si:ch211-247h9.1

Ensembl ID:
ENSDARG00000062880
ZFIN ID:
ZDB-GENE-081030-10
Description:
Novel protein similar to vertebrate contactin 4 (CNTN4) [Source:UniProtKB/TrEMBL;Acc:B8JI47]
Human Orthologues:
CNTN3, CNTN4, CNTN6
Human Descriptions:
contactin 3 (plasmacytoma associated) [Source:HGNC Symbol;Acc:2173]
contactin 4 [Source:HGNC Symbol;Acc:2174]
contactin 6 [Source:HGNC Symbol;Acc:2176]
Mouse Orthologues:
Cntn3, Cntn4, Cntn6
Mouse Descriptions:
contactin 3 Gene [Source:MGI Symbol;Acc:MGI:99534]
contactin 4 Gene [Source:MGI Symbol;Acc:MGI:1095737]
contactin 6 Gene [Source:MGI Symbol;Acc:MGI:1858223]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37632 Nonsense Mutation detected in F1 DNA Not yet available
sa14505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37632
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091416 Nonsense 169 1028 5 22
ENSDART00000131355 Nonsense 169 998 6 22

The following transcripts of ENSDARG00000062880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11869326)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11828128
GRCz11 23 11763098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGAGTTGACCTTTTCCTGGATCTTCAACGAATATCCCTCATTCGTC[G/T]AGCAGGACACGCGGCGCTTTGTGTCACAGAAAACAGGCAACCTGTACATT
Long Flanking Sequence:
TTTACTGAGAAACTGAAGAATGAGGTGACATGACAAAAAACCTTGATCTTGTTATGGCGGAAGTTGTAAACTACAAGCTTTACATGTTTATATCAGTTTTCTATCTTCTAAGCACAAATTTTATCACGAAGCACACTAGCTTATAGATATCTTAAAAACTAACAATACTGATACTAACATCTAAAAAAACCTTCATTTTAATTTCATGGGATCTTTAAATACTGAATTAAAACAAAAAATAGTTACATATTGGTCTTGGGGCACATAAACATGCAATCATCAATATTGTTTTTATGTAGGTTATTAACTTTTCATCTGTTTGAAAGTAAACTCTTCTGTGTCTTCTGTTTGCTTACATCTTTGGCCTCTAAAAAAATATTCACTTCTATTACAGTTTTTGTATACTCCAAAGAGATGCGGTTCAGTATAGCTTATTACACTTCTTGTCTCCTACAGAGTTGACCTTTTCCTGGATCTTCAACGAATATCCCTCATTCGTC[G/T]AGCAGGACACGCGGCGCTTTGTGTCACAGAAAACAGGCAACCTGTACATTGCTAAAGTGGAGCCATCGGATGTAGGAAACTACACCTGTGTCGTGACTAACACTGTGACCCAAAACAGAGTGCAAGGACCTCCTACACCTCTTATTCTCCGCAGTGATGGTGATACTCCTACCATATGCATTTTCACACAAAAATAATAATAAAGAACTGGCTGTAACTTCAAATGATCACCCTTTTTTACATATGTTTCAGGCATAATGGGAGAATATGAGCCCAAAATTGAGGTCCAGTTTCCTGAAGTCTTGGCTGTAGCCAAAGGGTTGACGGTCAAACTGGAGTGCTTCGCTTTGGGAAAGTAAATATTTCATTTGATACTTTTTAGGTGTTTATTTACTCTTTCGTCTAGTTTTTAGTTTAATTAGGGTGCATATGATCACACCAGTGTGATTAGAGCATTCAGTGCGTCAAGTGATTAGCTGCTGCATTAAAATCTGCATTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4242
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091416 Nonsense 454 1028 10 22
ENSDART00000131355 Nonsense 454 998 11 22

The following transcripts of ENSDARG00000062880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11928502)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11887304
GRCz11 23 11822274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATGTCCCCACGYGGGATGATCTCCTGGAGGAAGGGCAAGGAGGCCCTG[C/T]GAGAGAGCCAMAGGTATTTTTACCAGCCTATTTCACTTTGTCTGCCGAGA
Long Flanking Sequence:
TTCTAAAACGCCGTTTTAAAACTAATACGCACTAGTGTAAACGGGGCCTAAGTGTGTATTTTCGCAAGTGGGTTGCTGCTGCAACGGGGGCAGGGCAAAGGATCACAATGCCAGCTCAACATCATGATGTCTATCGGCCATTAACGATGGATGATGGCATCATCTATCAACCCAACCCTAGTTTAGATATCAGCTTTCATGATTCAATTCAAATTCAAATGAACCGCCATATCTGCCAAGTGTGAACATCCTTAAACAACTGCCACTTTTGAACATCGTATATCTCATTTTACTTTTGAAGTATGTCAGTCTGTCTCTCTGTCAGTCAGTTTTGTAAGCTGCTTGTTTTCTTGTTCACCTCAGCAGTGGCTCCAGATTTCTCCAACAGTGTGCTGAAGGCGCAGACATTGGCTCGGCAGGGTGGAGATGTTTTGATTGAGTGCAGGCCTCGCATGTCCCCACGTGGGATGATCTCCTGGAGGAAGGGCAAGGAGGCCCTG[C/T]GAGAGAGCCACAGGTATTTTTACCAGCCTATTTCACTTTGTCTGCCGAGAACGAGTGCTTTATTAAAGTGATACAGACAGAGCAATATGATTCAGGTCAGGCGGTGGGTTGTTACTGATCAAAGGCTTGATTATTCACATCAAAACGTCTCAACACAACAGACGCTGCATTTGCATTTACTTGATCTAGAAATAAAAAAGAAGGAAAGAAAGAAAAAAACAGAAAAGCATCAACAGTACTTGAATAATCAACCAACCACTGATCATTCAAACTGTGGATTTTAATACAGAGCCTTGTGATTAGGAGAAAAGTTTACTTTGTAGAAGTATTGACAAAGAATATTAGTTTCCATTTTTATAAAGTTTCTTTTTTGGTTAATATATAACACTGCTGCGGGCAGCACAGTGCCACAGTGGGTAGTGTTGTCGCCTCACAGCAAGAAGGTCACTGGTTCGAGCCCTTCCTGGGTCAGCTGGCATTTCTGTGTGGAGTTTGCACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14505
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091416 Nonsense 538 1028 12 22
ENSDART00000131355 Nonsense 538 998 13 22

The following transcripts of ENSDARG00000062880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11948637)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11907439
GRCz11 23 11842409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCCATGTCAGGTGTCACGTGACCCTTCACTGGATGTCAGAKTCACCTG[G/A]TTTTTCAATGAACAGCTGATYAACTTTGGAAGCCATGGGGGATATTTYGA
Long Flanking Sequence:
AAGTATATTCTAGGTCTGATTCTAGTGGGAAAGTTATCATATTGCATTGTTCGTATATATCTTAACATGTACATTGTGGTAAGAGCAAGGATTTCAAATATTGGGGGGGGGAGACAATTTAGCCATTTCAGATTTCTTGAGGTACTTGGTGTTTATAGTGGAAACAGTTGTACTTTTACAAGGCGCAATTTCTTTCTATTGATGAAAAACTAAGAGCATAGTGACATCTAGTGGTGCTAGAATTGTGCTACAACAGCACTGATTAACACGTTACCTCTTGATCTACTGATTATTTTCAAAAATGTTACCGGCGAATATCATGTCTTTCAATACAATAAATGCTGTTTTATGTATATTATAAATGCATTTTCTCTAATTGTCATTTTAGAACCAACCATCATAACATCCAAAGCCACCCAGCTGGATGTCACAGTTGGAGAGAGTGTTGTTATCCCATGTCAGGTGTCACGTGACCCTTCACTGGATGTCAGATTCACCTG[G/A]TTTTTCAATGAACAGCTGATCAACTTTGGAAGCCATGGGGGATATTTTGAAAAAGTTGGTGGTGTATGTGCAGCTCTATTATTCATTCATTTTTAGCTTGTTTGGTTTTTTTTTTTTCCTGACCAACACATGACATGACCAGTCAAAGAAATCAGGCAATCAGCTCATAACGAGCAAGAAGCTGCTTAAACAAGCAGCCATGTGTCAAAACTAGCCCATGCAGTTTTTTTAGCAAATCATAATGTAAAACATTATGATGCCCAAACTAGGGCCTGGGGGGCAAAGATGGCCCATGCTAACTTTTGATTTGGACGCCACCCCATCTATGAATGGATTATGTATATATTATCATTTCAAATGTAATGTAAAATTTTATTTGTTTGTTTTTTTTTTGCTACAAAAAAGCTATTTGAAATTAAATGCTTTAATTTAAATGCTGTCAATTAATCAGATATATATATATATATATTATTATTACTGTTATTATATATAGACTTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5032
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091416 Nonsense 732 1028 17 22
ENSDART00000131355 Nonsense 732 998 18 22

The following transcripts of ENSDARG00000062880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11957645)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11916447
GRCz11 23 11851417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGCGTGTTTGTTTTTGTGGACCTCTTYAGYCAGTCCCAGAAGAGCAA[C/T]AAGCTGGTCCAGGGTTCGGCTATGTGGTCGCTTTTCGCCCTMTTGGTGGY
Long Flanking Sequence:
AAATTGTACTGTACTAGCACAGTGCCCTGTTTGTCTCTTCATAAGATGTAGATGTTCATTAGTTGGTGTTGTAGATATTGAGCATTTTAGTCAGTAAAAGTCTGGAAGATTGATATTTGACTCAAATCGGGTACATTGTTAAGTGCACAAAGGTATCCATCAGTGGTGGACCATTCACTGGCCTGCATTACAAACAGGCTTATCATGCTGTCAGCATAGTCAGTCTATAGTTCAAGCAGCTCTTTTGTTACAAATATGTTTTTCAGCAAGTAAGACACATTTTTTTTTTATAGATTTTTAGCTATTATGTTTCAAAATATGAAAAGAGAAAAATATGTTCAAGAACGGTGATTGAGATTTTACATGGTCTGAGACAAAACCTCTTATTAAACTAATCATTGATATATTGCTACCTCAACAGTATTTTTCACTTGCTTTTTCTCTCATTTTTTGTGCGTGTTTGTTTTTGTGGACCTCTTTAGCCAGTCCCAGAAGAGCAA[C/T]AAGCTGGTCCAGGGTTCGGCTATGTGGTCGCTTTTCGCCCTCTTGGTGGCCAAAACTGGATGCAGGCGGCAGTTACATCTCCTGATGCATCACGATACATCTTCAAAAATGACAGCATCCCTCCTTTTTCTCCATTTCATGTCAAAGTGGGAGTTTACAACAACAAAGGAGAAGGTCCTTTTGGACCTGTCACCACTATATACTCTGCAGAAGAAGGTACTATACTGTAAAAACAATGCACAAGCTCCCATTTTCGGTACAGTATAAACTCAGTGCTACAGATATTTATTTTGTTTAATGTAAAGATATATCTAAGCTGCTGGTCAAAAGTAGTCAATTATGCTCAGAGTGACTGCATCTATTTGAAGAATAATAGAGTAAAGAGTTTGTATAAATTCAACTTAACAAAATCACTGAACATGTACAAAATGGTCTATTTTTAATATGTTAGTTTTCAAACTTTCTATTAAGCAAAAAAAAAAAAACTATATGTTTTTAAT
Associated Phenotype:
Not determined