Busch Lab

ZMP

slc2a11l

Ensembl ID:
ENSDARG00000062873
ZFIN ID:
ZDB-GENE-061215-118
Description:
solute carrier family 2 (facilitated glucose transporter), member 11-like [Source:RefSeq peptide;Ac
Human Orthologues:
AP000350.10, SLC2A11
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 11 [Source:HGNC Symbol;Acc:14239]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34877 Nonsense Available for shipment Available now
sa18983 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21705 Nonsense Available for shipment Available now
sa41625 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34877
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091357 Nonsense 5 504 1 12
ENSDART00000144847 Nonsense 5 504 1 12

The following transcripts of ENSDARG00000062873 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17531707)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17544053
GRCz11 10 17501487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCATACAGTAGAGCAGCACTTCACTGACACATACAATGACGGGGGCTT[T/A]ACGACAACTGGTACCATCACAACTATAAAATTACATGTTACTTTCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18983
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091357 Essential Splice Site 41 504 2 12
ENSDART00000144847 Essential Splice Site 41 504 2 12

The following transcripts of ENSDARG00000062873 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17531525)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17543871
GRCz11 10 17501305
KASP Assay ID:
2260-3089.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACCTTCCAATACGGCTTCAATATTTCTGTCCTGAACTCCCCGTCACCC[G/A]TAAGTACCATTGTTTTTTTGGTAAAAAAAAAATCTTGTGGTGATTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21705
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091357 Nonsense 369 504 10 12
ENSDART00000144847 Nonsense 369 504 10 12

The following transcripts of ENSDARG00000062873 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17518219)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17530565
GRCz11 10 17487999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTCCTGAGATTGGATTTGTCCGGTTCTGTTATAGGATTTTGTGTCCT[G/A]GATGCCATATTGCAGCATGGTCCTCATTTTCATATACATCTTCTTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091357 Essential Splice Site 390 504 11 12
ENSDART00000144847 Essential Splice Site 390 504 11 12

The following transcripts of ENSDARG00000062873 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17518052)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17530398
GRCz11 10 17487832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTTTGTGTCATGTTGGTCTCAGCATTATTGTGGATTTCCTCCTTCAT[A/G]GCTGGAGTGACAGCACCACTTCCTGGTGAGATTTTTACACAGTCCTACAA
Associated Phenotype:
Not determined