Busch Lab

ZMP

gk5

Ensembl ID:
ENSDARG00000062864
ZFIN ID:
ZDB-GENE-061110-49
Description:
Putative glycerol kinase 5 [Source:UniProtKB/Swiss-Prot;Acc:A0JPE9]
Human Orthologue:
GK5
Human Description:
glycerol kinase 5 (putative) [Source:HGNC Symbol;Acc:28635]
Mouse Orthologue:
Gk5
Mouse Description:
glycerol kinase 5 (putative) Gene [Source:MGI Symbol;Acc:MGI:2443336]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32875 Nonsense Mutation detected in F1 DNA Not yet available
sa19717 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25787
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091351 Essential Splice Site 221 529 7 16
Genomic Location (Zv9):
Chromosome 2 (position 16492824)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17003651
GRCz11 2 16672241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACAGATTACTCTAATGCTAGTGCAACAGCAATATTTGATTCCTATCAG[G/T]TCAGTTACACATGTTCAATTTGTTTAAGTGCTGTTATCTGATCATTACCT
Long Flanking Sequence:
CCGAACAGGCACTGGTGGGCAGAGTTGGTGTAAATAGCCTCTGCCAACAGAGCAAACTATTTGCACTTAGTATAGACAGTTTTGATTAAATTTGCCTATTTCTTACTGACTTCGATTTTTGCTTTAGTAACAATGATGTGTTTGTTTTAGAAGCATGAGTCAGAAAGAAATTCTGTCACGCACAAGACAAAACATCAATGCCTATAAATAACTTCTGCAAGTCAATGAAAATGCTGAACTAAGCAACTGTACTGTCTTTGTGTCCAACTGCTTAATCACGTATAACTTGTTTCACGTTATTTATATCTGATTCTACTATTTTGCATATTTATCGCTGTAAACTGAAATAAAGGTTGATTGACTCCTAGACTTGGGAAACAAAAACCTATTCTAGAGTTTGACTTCAAGTCTGTTTTATTGTTGTTTTCTTTTTTGCAGGACTGGTTCATGCCACAGATTACTCTAATGCTAGTGCAACAGCAATATTTGATTCCTATCAG[G/T]TCAGTTACACATGTTCAATTTGTTTAAGTGCTGTTATCTGATCATTACCTTTGGATTGTAGACCAGAGTACATACAAACAAACGTGCCCGAGACATAAACAAATAGACAGTTGAAGGGAAAGTTCAACCAAAAATGGGCCGTCTGCTTCCCCTTATGATTTTTAAATATGTATCGACTTCACTTTTTAACAGGGAACACAAAAGAAAGTTGTTTTGCATGTTTCTTTTATGTTTGGTAGTATTTCATTTGCAAATCTATTCTTATTTGGAAACGAATCACATTGTTTTCTTTAGTAACATAAGAATTAACCCTTTATCGGCTGAAGAACTGTATATGGTAACTTCATTGACATTGATTACAATAGAATTTTTACAAGATTCAAAAGTCTTGAAATATCTCCAGAGTTACTCCAGAATGAGTATTTTAATGAGTGCCTTATAAAGGGTAAAAATCGGGTCAACATGCCTTTATCAGTCTATCATTTTTTGGCGAATAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32875
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091351 Nonsense 455 529 15 16
Genomic Location (Zv9):
Chromosome 2 (position 16510124)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17020951
GRCz11 2 16689541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGACTTCATCATGCAACTGACGGCTGATCTGTTGGGACGCAAAATCGCA[C/T]GACCAAGCCATTTCGACATGTCCTGCCTTGGAGCTGCTTTTGTTGCAGGA
Long Flanking Sequence:
TTTTTTGTAGCATTAGGTTTTTCACATGTATTTTAAATGTGTAGTTTTAATCAGAACATGTACTTGTATGTTTTAAATTAAATATAAAATTAAAAACACAAAATATGCCAAAATGATGCTGGTGAATTTAGAAGAATTTGCCAAAACACAAAACGGTCCCATGAGCTACTTAACAGTAGCAGCCACAGTTAAATACAGTACATGCTTGTCTAGTCATATTTACCTTGTGTAGTTCTTGTACGGCATACATCATGTACTAACTGTCAAAAAACTAATTTGATTGTGATTTTCAGGAACAAGCAGCTCTTTGATGTCATGCTTCGTGAAACCCGTATCCCTATCACTAAAATCAGGTGAGGCTCACTTCCTGTGAAGCACAGTTTGATCCTTCCTCTATGAACTTTAGTGTATTTCCACACATTTACAGGGCAGATGGAGGCGTCTGCACCAACGACTTCATCATGCAACTGACGGCTGATCTGTTGGGACGCAAAATCGCA[C/T]GACCAAGCCATTTCGACATGTCCTGCCTTGGAGCTGCTTTTGTTGCAGGACTGGGAACCGGTAAGGAGCGTTTGTTAGAAATAACTGATTTCCAATTGAGACTTAATCCAGGGGTTAGATTAACCCTAAATAGACCACACTGTCCTTTCATACACACATTTATCACAAACCTTGCTTTAAAAAGGGACAGTTAACCCAAGAAATGTCCTCTTTATTTACTCGCACTCAAGCAGTGGTGTGAAGTAACAAATTACAAATACTTAAATTACTGTAACTGACTAGTTTTCTCAGGAATTGTAATTTACTAGGTAGTTTTAAAAAAAAGTGTGCTTTTAATTTCTTTTGAATTAATTTTTTAGTGCTGTATTGGTATTTTTACTCTACTGTTTTCCTTCAATCTGTAGTCACCACTTTATTTTTTCTTGTCTATGGGGATTAGAAAAATTTGCCTGTGATTCCTGTCCAATCAAATCGCACATAGACGGTAAAATCGCATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19717
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091351 Nonsense 477 529 16 16
Genomic Location (Zv9):
Chromosome 2 (position 16514308)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17024836
GRCz11 2 16693426
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTATCCTAATCTGCATGCTTTATTCTGAATTGTCTTTTAGGCTACTG[G/A]AGGAACCAAGAAGAGCTGAAGAAGCTTTTGTCAACTGACCAACATTTCCT
Long Flanking Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCCATAATCCTTTACAATGGAAATCACAAGCGTGTATAAATCAAGATTGCAAACTATTTTAGGGGTTAACTGTGCAGCTCTAACACATAGATTTTGTTTTACTGTACAATAAACTAGCTTATTGATGTTTGTCAGGCATATTGACTTAATCTTTCGAAGCCATCGTGTGTTCCTACCTCGATAAAACTGTTGAATTCTACCAAGAGCAATGCTCTTGTAGTATATTAGCACCTGACTGTGTTATATTTTTACATTTATATAAAGTCTCATTTTGTAAACAATTTATGGTTTTAATTGTTTTTTTTTTTCTTAGAGCAATGTTGTATCATTTTATTTTATTTTTTTGGCCAAGACAAATTTTCTCTCGGGGACAAATAAAGTTTATCCTAATCTGCATGCTTTATTCTGAATTGTCTTTTAGGCTACTG[G/A]AGGAACCAAGAAGAGCTGAAGAAGCTTTTGTCAACTGACCAACATTTCCTTCCCAGACGGAGTAAATCAGAAGGGGAGAAGGGAGGCCTGTACAGAGGAGTGCTGCAGAGCTGGGAGAAAGCCCTTCAGCGCTCCATGCACTGGTACAACCAGCCCTGATTCACCAAAAAGCACACACTTATCCTGCAAACTCCATCCTCACCACTGCATATTCTCTCAGTGTGACTCAGGGAGAAATAAAATAACATAATGAATCTGAAAAGGATTCATTTGGAAACTTCAACGGTTACACTTGATGAGTCAATAAATCAAAAGAGGTTTTACAGATTTACAGCTGGTTTGTGCAAATGTGAATCCAGCGCTATTATGATGACAATTCCTACTTCAGAATAAGACAGTTATATATAGTATTATTTAGATTTTGCCAATCAATAATTTAGTCATTAGGTGCCTTTATGAGGTGCCTTTATCTAATACTGTTTAAATTATGAACTCTCTTT
Associated Phenotype:
Not determined