Busch Lab

ZMP

si:dkey-211h10.2

Ensembl ID:
ENSDARG00000062806
ZFIN ID:
ZDB-GENE-030131-1582
Description:
Wu:fb75c08 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLV9]
Human Orthologue:
TTLL9
Human Description:
tubulin tyrosine ligase-like family, member 9 [Source:HGNC Symbol;Acc:16118]
Mouse Orthologue:
Ttll9
Mouse Description:
tubulin tyrosine ligase-like family, member 9 Gene [Source:MGI Symbol;Acc:MGI:1913589]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39399 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091200 Essential Splice Site 181 410 5 12
ENSDART00000128551 Essential Splice Site 206 435 7 14
ENSDART00000134776 Essential Splice Site 206 417 7 15
ENSDART00000141204 None None 149 None 5
Genomic Location (Zv9):
Chromosome 23 (position 12249209)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12208011
GRCz11 23 12142981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGCTACGTCGCTCAACGTTACATTGAGAATCCCTACCTTATAGCTGG[T/C]ACATCTAAGACTTTTCGCTTTAGTACTTGATTTCTTTATTTGTATGAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29887
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091200 Nonsense 299 410 9 12
ENSDART00000128551 Nonsense 324 435 11 14
ENSDART00000134776 Nonsense 324 417 11 15
ENSDART00000141204 None None 149 None 5
Genomic Location (Zv9):
Chromosome 23 (position 12251004)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12209806
GRCz11 23 12144776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCAGAAGACCATCATCAATGACAAACACTGCTTTGAGCTGTACGGATA[T/G]GACATTCTGCTGGACCAGGACTTAAAGCCGTGAGAATGCTTTTTTTATTG
Associated Phenotype:
Not determined