Busch Lab

ZMP

baiap2a

Ensembl ID:
ENSDARG00000062799
ZFIN ID:
ZDB-GENE-060421-2756
Description:
BAI1-associated protein 2a [Source:RefSeq peptide;Acc:NP_001035335]
Human Orthologue:
BAIAP2
Human Description:
BAI1-associated protein 2 [Source:HGNC Symbol;Acc:947]
Mouse Orthologue:
Baiap2
Mouse Description:
brain-specific angiogenesis inhibitor 1-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2137336

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa33307 Nonsense Mutation detected in F1 DNA Not yet available
sa11319 Nonsense Available for shipment Available now
sa40162 Nonsense Mutation detected in F1 DNA Not yet available
sa9258 Nonsense Mutation detected in F1 DNA Not yet available
sa33308 Nonsense Mutation detected in F1 DNA Not yet available
sa8395 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33307
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 9 490 1 12
ENSDART00000123659 Nonsense 33 514 2 13
Genomic Location (Zv9):
Chromosome 3 (position 52362153)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51487561
GRCz11 3 51742224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTCTTGCTTGCAGAACATCATGGAACAGTTCAATCCCTG[T/A]TTGCGGAATTTCATCGCAATGGGCAAGAACTACGAGAAGGCTCTCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11319
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 177 490 6 12
ENSDART00000123659 Nonsense 201 514 7 13
Genomic Location (Zv9):
Chromosome 3 (position 52481705)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51607113
GRCz11 3 51861776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGCAGAGGGCTACAAAACAGCGCTTTCAGAGGAACGTAGGAGATACTG[T/A]TTCCTGGTGGACCGCCAATGCGCTGTAGCCAAGAACAGCAGYGCCTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40162
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 258 490 7 12
ENSDART00000123659 Nonsense 282 514 8 13
Genomic Location (Zv9):
Chromosome 3 (position 52491667)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51617075
GRCz11 3 51871738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACTCATCCAAGGGGAACCTGGTCATCTCAGATCCCATTCCTGGAGCA[C/T]AACCGCTGCCCGTGCCCCCCGAACTAGCTGCCTTCATGGGAGGTGGCCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26149
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Essential Splice Site 277 490 7 12
ENSDART00000123659 Essential Splice Site 301 514 8 13
Genomic Location (Zv9):
Chromosome 3 (position 52491728)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51617136
GRCz11 3 51871799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGCCCCCCGAACTAGCTGCCTTCATGGGAGGTGGCCTGGGCCAGGGGG[T/C]TAGTAAAGAACATTAGCCACCTGTTTAACAATACAAATGACTAACTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9258
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 343 490 8 12
ENSDART00000123659 Nonsense 367 514 9 13
Genomic Location (Zv9):
Chromosome 3 (position 52493916)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51619324
GRCz11 3 51873987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGCGACGTMTATTCCAACACCCTGCCTGTCCGCAGGCCTCAGYCCGCT[A/T]AAAACAAGACCACTGTGGGTAAGAAAACAAACTGTTTTGCTTAGCCATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18768
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
Genomic Location (Zv9):
Chromosome 3 (position 52496033)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51621441
GRCz11 3 51876104
KASP Assay ID:
2259-4104.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACACCCGAGTGCTGCCTGACAGTGATGGCGAAAAGTTAAGAGTCAAG[T/C]AAGTGTATGTTTCTGTCCTTATCTATAAAGTTTTTGGCTTCATGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3458
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
Genomic Location (Zv9):
Chromosome 3 (position 52496033)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51621441
GRCz11 3 51876104
KASP Assay ID:
2259-4104.1 (used for ordering genotyping assays)
KASP Sequence:
CCTACACCCGAGTGCTGCCTGACAGTGATGGCGAAAAGTTAAGAGTCAAG[T/C]AAGTGTATGTTTCTGTCCTTATCTATAAAGTTTTTGGCTTCATGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 477 490 11 12
ENSDART00000123659 Nonsense 501 514 12 13
Genomic Location (Zv9):
Chromosome 3 (position 52499260)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51624668
GRCz11 3 51879331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGCCTGACTATGGGTTGACTGCCCGACTGTTGGCACAGAGCCTTACA[C/T]AGAGCCGACAGCGTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8395
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
Genomic Location (Zv9):
Chromosome 3 (position 52499269)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51624677
GRCz11 3 51879340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTATGGKTTGACTGCCCGACTGTTGGCACAGAGCCTTACACAGAGCCGA[C/T]AGCRTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACACAAACTAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5229
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
Genomic Location (Zv9):
Chromosome 3 (position 52499269)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51624677
GRCz11 3 51879340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTATGGKTTGACTGCCCGACTGTTGGCACAGAGCCTTACACAGAGCCGA[C/T]AGCGTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACACAAACTAGC
Associated Phenotype:
Not determined