Busch Lab

ZMP

si:ch73-218h2.1

Ensembl ID:
ENSDARG00000062796
ZFIN ID:
ZDB-GENE-100921-75
Human Orthologue:
FKBP10
Human Description:
FK506 binding protein 10, 65 kDa [Source:HGNC Symbol;Acc:18169]
Mouse Orthologue:
Fkbp10
Mouse Description:
FK506 binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:104769]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29181 Nonsense Mutation detected in F1 DNA Not yet available
sa23493 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29181
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104447 Nonsense 35 569 1 10
ENSDART00000142475 Nonsense 27 555 1 10
Genomic Location (Zv9):
Chromosome 19 (position 18185952)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19031187
GRCz11 19 18494040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTTAGAAGATGTAATTATTGATCGCTACTTTATACCAGCGTTCTG[T/A]CCAAGAGAGGTTCAGATCGGAGACTATGTTCGGTATGACTATAACGGAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4800
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104447 Nonsense 83 569 2 10
ENSDART00000142475 Nonsense 75 555 2 10
Genomic Location (Zv9):
Chromosome 19 (position 18198820)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19044055
GRCz11 19 18506908
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCCATTCATTGGGCAGGTGGGTGTGGAATCAAAAGTCATCCCAGGTT[T/A]GGATAAAGGAGTTCAGGGCATGTGTGTTAATGAGCGAAGGAAGATCACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29182
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104447 Essential Splice Site 338 569 7 10
ENSDART00000142475 None None 555 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18224206)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19069441
GRCz11 19 18532294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATGTTTATGTTTAACCTAGATTTTTCCTAATCTGCTCTTTTTTTTTT[G/T]TACAAATTCAGGTGAGCTAATTCCTGGATCTGCTGTGCTCATCTTTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23493
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104447 Nonsense 391 569 7 10
ENSDART00000142475 Nonsense 378 555 7 10
Genomic Location (Zv9):
Chromosome 19 (position 18224369)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19069604
GRCz11 19 18532457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCTTGCAACCTGACAAGTGATGCAAATGATCTGATTTTGTATCGCTA[T/A]AACTGCTCTTTGTTGGATGGCACACGTCTCTACTCTTCGTAAGTACTCCC
Associated Phenotype:
Not determined