Busch Lab

ZMP

abcb7

Ensembl ID:
ENSDARG00000062795
ZFIN ID:
ZDB-GENE-050517-10
Human Orthologue:
ABCB7
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 7 [Source:HGNC Symbol;Acc:48]
Mouse Orthologue:
Abcb7
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 7 Gene [Source:MGI Symbol;Acc:MGI:109533]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42355 Nonsense Mutation detected in F1 DNA Not yet available
sa407 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42355
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091169 Nonsense 59 743 2 16
Genomic Location (Zv9):
Chromosome 14 (position 11186359)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10681716
GRCz11 14 10987730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATGTTTTTTCACTTTCATTTAGTTGTCAGACCCAAGCAGAGAGTCCT[C/A]AACATGGGCCAACAACAGAGGCCAGAACAGCCAACAGATTCTAGAAGCTG
Long Flanking Sequence:
TTAAAAATGTGTTTGTCACTACAATAATTTTTCTAAGAGATTCTACAAAAATGCTGCTTTATTCAGTAATGAAAGTGAAGTCTTTGAGTGAGTTCTTGAATCATTGAAATCGATATTTTAAAAAATATAATATAACATGAAATGTTATATGAAATTTTATACTTTCAGATACGTAGTGGTCATTCAGGACCTTCATTGTAAGCGAATGAACACTGAATACAAATATTAAATGTGCTTATAATGTGAGTAAGGTGAAGTAGAGGTAAAAAGCATCTTATTGATTCCTATTTAACAGGCTTTATATTGACTGTGAAGGTCTGATAGCAAATAGATTTATACCTCAGGGTGAATGAGATGGATTTAAGCAAAGACATCTTTCAAAAAAGCTTTTTAAGTGCAGTAGTATGTAGTTTTAGAAATGACAAAGTAGGTATACCTTATACCTCACATCTCATGTTTTTTCACTTTCATTTAGTTGTCAGACCCAAGCAGAGAGTCCT[C/A]AACATGGGCCAACAACAGAGGCCAGAACAGCCAACAGATTCTAGAAGCTGTCAAAGTAAGTGGCATTTAAATCCAAAACATAAGACAGTGTGCTTGATATTTTTTAATGAAGTGGATTAAATGGATCCACAGGCTTACACACACACACAAACAGGCATGGGATGATAACCGTTGTTAAAGCAGGGTTCAACGCTAAGGATTTTTTCTACTGGCCAGTACTTCAGATTTTTACTTGTCCTGCCAAATTTTCTCTGGCCCCACCAAAAAAAAAAAAAAAAAGAAGTTAATTGCTATTTCTGAGCCACATACGGTATTTTAAATTATGTCAAAAGCCAAACATATTTGGAATACCTACCCTTTTTATTCAGCATAATTTTTTTTTTAAAGAGCCCATATTATACATTGAAATAGGGTCATATGTTGGTTGTAAGGGTCTCCAACAACAGTCTAATATGCATGCAAGGTCAAAAACACTTTCATGGTCTTATAATCTGCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa407
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091169 Nonsense 210 743 6 16
Genomic Location (Zv9):
Chromosome 14 (position 11221368)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10716725
GRCz11 14 11022739
KASP Assay ID:
554-0266.1 (used for ordering genotyping assays)
KASP Sequence:
GATCGGCTCTCTTTAATGAACTCAGAAATGCCGTGTTTGGAAAAGTGGCA[C/T]AGAGCTCCATCAGGAGGATAGCCAAGAATGTGTTTCTCCATCTTCATAAC
Long Flanking Sequence:
CGGGGCATACATACTTCTTGGGTCAGACAGAGTTTAAACTGCATCAAGGTATGGTGGGAAGTTGGCTGGTTTGACGAGCTTTAGGTAAAGATGAAAAACTCACAGCACACTGTTGTCATGCAGTCGAGTGTGTGTTTCCAACCTCTGACTAAAAATATTCCCTGCAGCTTATTATTATTTATACAAACGCACATGCTAATAATATGCAGTGTGCTACATTAGGCTCTTCCTTTTATCATTGCCAAGGGAATGGAAGTGCAACAGCAACTGCCTCCAATAATTCGTAATATATTGGTCATTTTCTTTGCCATGCACAATGTTTTTTGCTTTTTCTCCAGCATCTATGTAATTGAGTGGCACACACTTTATCTCATCTTTGTTTTCTCTCGTTTTAAGTGTTTGTTCTGCTCTTCATTGACTGTTTGTTTTTAGATGGTGTTTCCCGCACTGGATCGGCTCTCTTTAATGAACTCAGAAATGCCGTGTTTGGAAAAGTGGCA[C/T]AGAGCTCCATCAGGAGGATAGCCAAGAATGTGTTTCTCCATCTTCATAACCTGGATCTGGGCTTCCACCTGAGCAGGCAGACAGGAGCGCTGTCCAAAGCAATCGACCGCGGCACTCGAGGAATCAGCTTTGTGCTCAGCGCACTGGTCTTTAACCTGGGGCCTACTCTTTTTGAAATGATGCTTGTCAGTGGCATATTGGTAAGTTCCTATGGAATCCTCATAATTTTCGCAAGTTTATAAAGCCACTACTTTACCATAAAGCCATGGTCACGATGCACATTTCGCCCCATAGACTTCCATTAATAAGCATGCAAATGCAAAAGACTGGAAATGCAAGCTTGGTAAACTTGGAACTTGCGGAATCGAATCACGTAATTGTGAAAGACCAATAGAAGATCAAAACAACCTCTCAATAGAGAAATTTTAAATATGGAGCAATCACTCGCTCTGTCAGTGTCTAATCATCTTGCTTTATCCTGACATTTCGCAGCGCTCTAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28270
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091169 Nonsense 295 743 7 16
Genomic Location (Zv9):
Chromosome 14 (position 11227897)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10723254
GRCz11 14 11029268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGTGGAGGTCACTTTGCTCTGGTCACTCTAGGAACTCTTTCGGCATA[C/A]ACTGCCTTCACAGTCGCTGTTACACAATGGAGGTACTACATGTGTCTCTC
Long Flanking Sequence:
TTCTAAATGACTTTATTAATATTATTTGAGTTTTTTAGTCATTGCAGAATAGTATGGATGCAGTCCTCCAAGCTCATGGGAGTCATACACAATATTAATTGTTATAATATCTCATTCTTTTTCCACTGCAGCATGACTTTATATTCTATACTGTACATTATTTCTGTTTAAGTGACAAGACTTTGTTTAAGCAAAGTCAGACATTACTATTCTATTTAAAAAAATGAAAATCAAGGCATGATCATATTTTATTTTGGTAAAATAAGTGTAATCTGCCTTTCGTATACACTTCTGATGCCAAATGATAAACTAGAAGTCAAGTTATTATTTGTTATTTCTAAAACCTGGATAGACGACAAGACTTTTATCTGGTAGTCTACAGTATAAGAAGACATGTCACTTTGTCAGTTATCAACAGCTGTTCTGCTTTTTTTTTCTTTGCAGTATTATAAATGTGGAGGTCACTTTGCTCTGGTCACTCTAGGAACTCTTTCGGCATA[C/A]ACTGCCTTCACAGTCGCTGTTACACAATGGAGGTACTACATGTGTCTCTCAAATAGCAGTCATTTTTGTAACAATGAATGCATTTTGTTCTGTGCTGTATAACAGTAACCCATCTGTGTTTTCGATCAGGACGCAGTTCAGGATTGAGATGAATAAGGCTGATAACGAGGCGGGAAACGCTGCTATCGATTCTCTCCTCAATTATGAAACTGTCAAGGTGAGTCAACGCAATAAACTCCATTGCCATTGTCATAACTTTATTGACTCAAGACATACTCTCCATTGTTTTTGATTGTTTTCTTGCAGCAGTATAAACATTTTGGTACCATTTATTTAAAGTCATTCCATAAGTAGAAGCTCAAAAGTGTGCTTGCTTAAAGGTGCTGTATGTTGTATGTAAAACTCTTCTAAAGCATAAAAATATCATAATATGTTTGCAGATATTTAAGAAACATGCCAAGTTATCATTCTTGTTTATCTGAAAAACAATGCTGAAGTCA
Associated Phenotype:
Not determined