Busch Lab

ZMP

TACC2

Ensembl ID:
ENSDARG00000062790
Description:
transforming, acidic coiled-coil containing protein 2 [Source:HGNC Symbol;Acc:11523]
Human Orthologue:
TACC2
Human Description:
transforming, acidic coiled-coil containing protein 2 [Source:HGNC Symbol;Acc:11523]
Mouse Orthologue:
Tacc2
Mouse Description:
transforming, acidic coiled-coil containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:1928899]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35509 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15379 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3852
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101653 Essential Splice Site 913 1297 8 19
Genomic Location (Zv9):
Chromosome 13 (position 29094671)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28740619
GRCz11 13 28871069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCGACTTCACAGCTTTTGTCAATGAGAACAGTTTYTCACAGAGTGATG[G/A]TAAGAGGACAAAAGATGGATGGATTTTATTTCAAAGGAATAATACTTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4507
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101653 Nonsense 1117 1297 14 19
Genomic Location (Zv9):
Chromosome 13 (position 29111197)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28757145
GRCz11 13 28887595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTTCTTCTTATTTCAGATTGTTGTGAAAGAGAAAGAAGCCATGGAGTG[G/A]AAGAGGAAATACGAGGAGAGTAGACGGGAGGTGGAGGAGATGAGGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35509
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101653 Essential Splice Site 1200 1297 16 19
Genomic Location (Zv9):
Chromosome 13 (position 29116372)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28762320
GRCz11 13 28892770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTCCGTCGCTACGAGAAGATGAAAGATGTTTTGGAAGGTTTCCGCAAA[G/A]TGAGTCACTTGAGAATTTTCATTTGGAGTTTATTTGAATTTTTGTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15379
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101653 Nonsense 1212 1297 17 19
Genomic Location (Zv9):
Chromosome 13 (position 29123737)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28769685
GRCz11 13 28900135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGTTTTTCCATCAGAATGAGGATGTCCTAAAGAAATGTGCGCAGGAATA[T/A]CTGTCTCGTGTTCGTAAGGAGGAGCAGCGCTATCAGGCCCTAAAGATTCA
Associated Phenotype:
Not determined