Busch Lab

ZMP

socs5b

Ensembl ID:
ENSDARG00000062745
ZFIN ID:
ZDB-GENE-080722-18
Description:
suppressor of cytokine signaling 5b [Source:RefSeq peptide;Acc:NP_001107269]
Human Orthologue:
SOCS5
Human Description:
suppressor of cytokine signaling 5 [Source:HGNC Symbol;Acc:16852]
Mouse Orthologue:
Socs5
Mouse Description:
suppressor of cytokine signaling 5 Gene [Source:MGI Symbol;Acc:MGI:2385459]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa9767 Nonsense Available for shipment Available now
sa35423 Nonsense Mutation detected in F1 DNA Not yet available
sa11807 Nonsense Available for shipment Available now
sa38920 Nonsense Mutation detected in F1 DNA Not yet available
sa6285 Nonsense Mutation detected in F1 DNA Not yet available
sa42137 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9767
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091097 Nonsense 172 557 2 2
ENSDART00000125735 Nonsense 213 598 2 2
Genomic Location (Zv9):
Chromosome 13 (position 7985218)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8289738
GRCz11 13 8621761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGAAGTTGGCAGCAGCGGGCGYAGCCTTAGCAGCCGTTCTCTGCGACAA[C/T]GACTTCGAGACACCGTGGGCTTGTGCCTTCCTCTCCCCACACACCGSCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35423
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091097 Nonsense 263 557 2 2
ENSDART00000125735 Nonsense 304 598 2 2
Genomic Location (Zv9):
Chromosome 13 (position 7985491)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8290011
GRCz11 13 8622034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATTCAGCCCATTCTTCACCTGAGGACGAGGAGGAGAGGCTGCGTGAA[C/T]GACGTAGACTTAGCATCGAGGAAGGAGTAGACCCACCTCCAAATGCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091097 Nonsense 283 557 2 2
ENSDART00000125735 Nonsense 324 598 2 2
Genomic Location (Zv9):
Chromosome 13 (position 7985552)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8290072
GRCz11 13 8622095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGCATCGAGGAAGGAGTAGACCCACCTCCAAATGCGCARATCCATACAT[T/A]GGAGGCAACTTCAAAGAGCTCTTCCCTCWATAAACTAGGACCAAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38920
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091097 Nonsense 287 557 2 2
ENSDART00000125735 Nonsense 328 598 2 2
Genomic Location (Zv9):
Chromosome 13 (position 7985564)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8290084
GRCz11 13 8622107
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGTAGACCCACCTCCAAATGCGCAAATCCATACATTGGAGGCAACTT[C/A]AAAGAGCTCTTCCCTCTATAAACTAGGACCAAAGATGGCTCCTGGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6285
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091097 Nonsense 385 557 2 2
ENSDART00000125735 Nonsense 426 598 2 2
Genomic Location (Zv9):
Chromosome 13 (position 7985859)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8290379
GRCz11 13 8622402
KASP Assay ID:
554-5421.1 (used for ordering genotyping assays)
KASP Sequence:
CACTGCTCCAGACAGCCAGGGCCTTGGAAGRTCCACACACAGATTGACTA[C/A]ATCCATTGTTTAGTACCTGACCTACAGGCCATAACTGCACTTCCTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42137
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091097 Nonsense 440 557 2 2
ENSDART00000125735 Nonsense 481 598 2 2
Genomic Location (Zv9):
Chromosome 13 (position 7986022)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8290542
GRCz11 13 8622565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTCTACGCGACTCCGCACAGGAGGACTACTTGTTCTCTGTTAGTTTT[C/T]GACGTTACAATCGGTCACTGCATGCACGCATTGAACAATGGAATCACAAC
Associated Phenotype:
Not determined