Busch Lab

ZMP

scn1lab

Ensembl ID:
ENSDARG00000062744
ZFIN ID:
ZDB-GENE-060906-1
Description:
sodium channel protein type 2 subunit alpha [Source:RefSeq peptide;Acc:NP_001038360]
Human Orthologues:
SCN1A, SCN2A, SCN3A, SCN9A
Human Descriptions:
sodium channel, voltage-gated, type I, alpha subunit [Source:HGNC Symbol;Acc:10585]
sodium channel, voltage-gated, type II, alpha subunit [Source:HGNC Symbol;Acc:10588]
sodium channel, voltage-gated, type III, alpha subunit [Source:HGNC Symbol;Acc:10590]
sodium channel, voltage-gated, type IX, alpha subunit [Source:HGNC Symbol;Acc:10597]
Mouse Orthologues:
Scn1a, Scn2a1, Scn3a, Scn9a
Mouse Descriptions:
sodium channel, voltage-gated, type I, alpha Gene [Source:MGI Symbol;Acc:MGI:98246]
sodium channel, voltage-gated, type II, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:98248]
sodium channel, voltage-gated, type III, alpha Gene [Source:MGI Symbol;Acc:MGI:98249]
sodium channel, voltage-gated, type IX, alpha Gene [Source:MGI Symbol;Acc:MGI:107636]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa20649 Nonsense Available for shipment Available now
sa20648 Essential Splice Site Available for shipment Available now
sa16474 Nonsense Available for shipment Available now
sa40640 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11144 Nonsense Available for shipment Available now
sa25330 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20649
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 113 1996 2 26
Genomic Location (Zv9):
Chromosome 6 (position 10212394)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10066201
GRCz11 6 10301740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTGGGAAGGCTATATTCCGCTTTAACGCTACGCCGGCCTTGTATATTT[T/A]GAGTCCCTTCAATCCATTAAGGAGAATCTCCATCAGGGTCCTGGTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20648
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Essential Splice Site 130 1996 2 26
Genomic Location (Zv9):
Chromosome 6 (position 10212342)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10066149
GRCz11 6 10301688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCCTTCAATCCATTAAGGAGAATCTCCATCAGGGTCCTGGTGCATTC[A/T]TATCCTTTATGAGCTGAATGGATGTATGTACGCACGTTTTCCTGTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16474
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 462 1996 10 26
Genomic Location (Zv9):
Chromosome 6 (position 10197140)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10050947
GRCz11 6 10286486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATTGGTTGGCAGGTTGCCGCGGCAGCAGCGACAGAGAGCGGGGAGTA[C/A]AGCGGAAGGGGGGGCCTGTCGGAGGAGAGCTCCTCTGGGGGGTCTAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Essential Splice Site 656 1996 11 26
Genomic Location (Zv9):
Chromosome 6 (position 10193968)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10047775
GRCz11 6 10283314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGCGGGACATCTGTGCCAACATCACCAATTGGACGTTTGCTACCTGAG[G/A]TATTTGAGTTGGATGTAAACAAACATGTTATCTATAAGAAAACTTCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 799 1996 14 26
Genomic Location (Zv9):
Chromosome 6 (position 10186709)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10040516
GRCz11 6 10276055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAATCTTCACMGCAGAGATGTGTCTGAAGGTCATTGCTCTGGATCCCTA[T/A]TATTATTTCCAAGAAGGCTGGAATATMTTTGATGGCATCATCGTGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25330
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 1185 1996 18 26
Genomic Location (Zv9):
Chromosome 6 (position 10171576)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10025383
GRCz11 6 10260922
KASP Assay ID:
554-7364.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTTTCAGTGCTGTCAGGTCGATGTGGAGAAGGGAAAATGGAAGAGTTG[G/A]TGGATTCTCAGGAAAACCTGCTTTATCATAGTAGAGCACAACTGGTTTGA
Associated Phenotype:
Not determined