Busch Lab

ZMP

cep290

Ensembl ID:
ENSDARG00000062727
ZFIN ID:
ZDB-GENE-041111-243
Description:
Centrosomal protein of 290 kDa [Source:UniProtKB/Swiss-Prot;Acc:P85001]
Human Orthologue:
CEP290
Human Description:
centrosomal protein 290kDa [Source:HGNC Symbol;Acc:29021]
Mouse Orthologue:
Cep290
Mouse Description:
centrosomal protein 290 Gene [Source:MGI Symbol;Acc:MGI:2384917]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa38048 Nonsense Mutation detected in F1 DNA Not yet available
sa6804 Nonsense Mutation detected in F1 DNA Not yet available
sa38047 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38046 Nonsense Available for shipment Available now
sa38045 Nonsense Available for shipment Available now
sa13473 Nonsense Available for shipment Available now
sa11985 Nonsense Available for shipment Available now
sa39478 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38048
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 306 2439 10 52
Genomic Location (Zv9):
Chromosome 25 (position 18477655)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17893965
GRCz11 25 17990365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGAGTGGAAGAGGACGACCCAGTTATGGCTGCTGTTAATGCTAAAGTC[G/T]AGGAATGGAAGGTAAGCCTGTCTTCCGAAATTTCAGCTTTGACATTATTA
Long Flanking Sequence:
TGTTCTTCTTGTTCCCAGCATGCCGAGGACATGGCTGCCAACCTGAGGAGTGAAAATGAGCACCTGCAGAAGAATCTAGAAGAATCTGTGAAGGAGATGGAGAAGATGACGGACGAATACAACAAGATGAAGATCGCTGTCCAACAAACGGATGCCATCATGGATCAATTGAGAAAAGACAGAGATCATGCCAAGCTTCAGGTAATTTAATCATGCTAATAAAAAAGGTCATTCCAGTCCCACATGCTGATCGATCTATTTGTTGTTATAGCCACATTCTCTTTTACTGCTGTTGGCAGGAAAATGTTTTGCATAATTCAGAGTGCTTTACGAGTTCACATGCATGGGGGGCCACTCTCTTTTATGATAGGAAAAATAAAAAAGATTGTTGCTATTCCTTTTAATGAGATGTGTTTTTCAAGGTAAGAGAGCTAACTGACCAGATCCAGGCCCGAGTGGAAGAGGACGACCCAGTTATGGCTGCTGTTAATGCTAAAGTC[G/T]AGGAATGGAAGGTAAGCCTGTCTTCCGAAATTTCAGCTTTGACATTATTAGCAACTTGTAGACAGTGGAGGGTTGTGACGTTCACGAACCCATGTCATTTCTACAGAAGTGGCGGATTGTTTTCTTTTGTCACCTTTTTGTTTATGTGGTTTACCTGCCTCAAATTGCTCACTTCATATTAAGAAGTTCTGAAGCAAAGGTAAATACTTGATTTAGTGCCAGAAACCTGTCAGCCAACAGTTTTGTCTTCCAAGAAGACATTTCAATAAAAACATTAACTTCTTTTTACATTACTAATGAACATATCTATGTAACATAACATATCTATATCTTTACTTCAGCTAAGTTTTCTTAATTCAATTTGTTTTCAAGTTATTTAAGAACACGTTGATCTCATAACATTATGCTTGCATGGTTTCTGAAGAAACACCATGCATTACTGTCATTGCATTTAAATAACAGAAATGCTTGGATAAAACCTTAAAGCTAATGCTGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6804
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 446 2439 12 52
Genomic Location (Zv9):
Chromosome 25 (position 18464969)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17881279
GRCz11 25 17977679
KASP Assay ID:
554-5375.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGACAAAGACAAAGAACTYAATGACACCCTYAGCAGAATCCGTCTGTA[T/G]GAGTCGGTGGGTTTGTRCCTTAACACTYACTTTTATGACCACATGTTTTA
Long Flanking Sequence:
ATTCTCTATGGTTTACAACTTGGCCGTCTCAGGTCATATATGAACTGTGTGGCGTGAGTATCTGTTTCTCATTTCCTTTGCTTTTTGTGTCATTCATCCTCTGTTTTGCATCTGTCATCTGTCATCTTTAGTCTGTTTCCTTCATATTGATTCATCTCGTTTTGTCCCAGCGGGGTTTAAGGCAGTCACTGGCTTTGTGTTTGTCTTCAAAAGGCCGTGCAAGAGAGGGACAACCAGATCAAGATGCTGTCGGAGCAAGTGGAGCAGTACACGACGGAAATGGAAAGGAATGCTATGCTCATCGAGGAGCTGAAAAGGCCATTGAAGAAAGATAAAGGTCATTCCAGCGACCACCAGCGTAGATTGGAGGATTTGAGTGCTAAACTCCAGGTTGCGGAAAGGAAGGTGCTGGAGGCTCAACGGGCCGCACAACTGGCTGAACGAGATGCCAGAGACAAAGACAAAGAACTTAATGACACCCTCAGCAGAATCCGTCTGTA[T/G]GAGTCGGTGGGTTTGTGCCTTAACACTTACTTTTATGACCACATGTTTTACATACTTTTGGAAATCATTTTGTATCGAGTCTTTTACCTAAATGTTATGCTTGAAAAGGAAATACATTCAAATGTATCCACAATTAGGACCGTCGTCAACATAATTATCTACACTTTTTAATTGCTAATTAATAATTATTATTTCTTATATTTAGTAAGCTATGACAGTCACTTTTAGTGCTAAACTTTTGGGCTTACTTTGTTATCCAGGCCTTATTGACGAAAACTTATTTTCTAATTGCATATTCAGCCTGATATGGTCACTTAGTATCTTCAGAAGAGCTTCAAATATTTGTTCAATATTTTTTTTTGTATTATTTGCTCAAGAAGATTAAATATTTGTGTTAAAAATAAATTCAAAATAAATTGTTTAAAAAATGCATATTTATAAAATATTACATATATCACTCGTATATAACATTTCTTTTCAATGTTTTTTATAATAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38047
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Essential Splice Site 623 2439 18 52
Genomic Location (Zv9):
Chromosome 25 (position 18460143)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17876453
GRCz11 25 17972853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGAGGTGTCAGTTGGCTGTTTTGACTGTAATGTTTATGTCTGTCCTGC[A/T]GTGAATGAAATGCTGAATGAGAATAAACAGCTGGAGCAGGGCATGAAGGA
Long Flanking Sequence:
TGGTCTTATGATCAGGATCGCCTCATAAGTAAAAACGTTCGCTCTAAGCTGCCTTTGACACATTTATAGGATTCCACTCGAATACAAATTATCCCTGTTAGTAAATAATGCTCTCATCACTGCAAAACATTTTGTAATAAAACCGTTTTTTTAAGGTGTAACAGTAGTCAGCAATTCACTGCTTGACAACAGTGTTGAAGAAAAGCCCGTCAGATCCCTAAGGCCTTCCTCTGGATCCACCGATGATGAAATCAAACGCAAAGTAAGCCTATATCAGAAAACAATTACTGCTGAACCCCATAAACATTAAAGCTAAGCTAACAAACTCTTTATTTTCATAGAACGAGCGCCTGCAGAAAGAGCTGAGCAACAAAGAGAAAGAGCTGGAACTCAGGAGAAGTGAATCTACCCAGTTCAAAGCCAAATGTGAGCGGCTTCACCTTTTGGATGTTTGAGGTGTCAGTTGGCTGTTTTGACTGTAATGTTTATGTCTGTCCTGC[A/T]GTGAATGAAATGCTGAATGAGAATAAACAGCTGGAGCAGGGCATGAAGGAGATACTGCAGGCCATCCAGGACACTCAGAAGAAAACGCCAACATCCACTGGTGTCAGCATTCCTAGCCTCGAGAGACTCGTCAATGTATGCATCAATGGTTTTTATATATTTATTTATTTATTTATTTTTTGTTTGTTTGTTTGTTTGTTTATGTATTTATTTTGGCAGATTTCATATATACAGTGCTCAGTGTAAATGAGTACACCCCCCTTTTAAAAATCAATATCTGTATTTATTTCTCAGTGAATATAGTCAACATTTTGGTGCATTTAAAGAAAACAGTTTTATTAAACAGATATGTGCATTAAAATAAGAGTTTTGGCATCTTACATCTTTAGGAATGGAAAGACAATGTATTTTTAAATTGAAAGTTATTGCGAAGAAAAAACTAAACTAAATTTTAATATTTTCCTCCGACATATTGATTTGGGTGTACTCATTTTTGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38046
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 765 2439 20 52
Genomic Location (Zv9):
Chromosome 25 (position 18454675)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17870985
GRCz11 25 17967385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCCGAAGAAATGACGCCCACTAGTGCGGAGGCCATCAACGCTCTCAAT[G/T]AGTACACGGTTCAGCTCCTGCAGGTGTGTGGCAGTCCAGTATTGTGTTAT
Long Flanking Sequence:
AAACTTTGAAAATTAGAGAGCAATGACAGAATATCATGGGAAGCAGAGAGATAGGAAGGATCAGCAAAGGTTCTCGAGCTGGGAATTGAACTCTGGTCACCGTGAGCATGTCTGTGTTATACGTCTTATTTAGGCTATTCAACTGACCAGTCCTTAAATCTTAGGTAGAAATTAAACTTTTAACACCATAATGACTTTTAGGTACTACTATCTCAGTCAAATTTAATATGCAAATAATTTGCGATTAATTTGATTCATTATTCATTTTAATTAATTAAATAAAAATGCAATCAACTGTCAGCCCTACTGTAAATATATCCACTTTTATGTTTTTCTTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTTTGTAGATCGCTCGCTTGGAAAGTGAGATGGAATCAATGAGCAAATCTACTGGCTCTTCCATCCCTCACAAGACATTAGCTTTGCCCGAAGAAATGACGCCCACTAGTGCGGAGGCCATCAACGCTCTCAAT[G/T]AGTACACGGTTCAGCTCCTGCAGGTGTGTGGCAGTCCAGTATTGTGTTATGATGGAAACCATATGTGAGGTGTACATAATATTAAGACTCCCAACTGCGGATGTTCAGGAGATCAAAAACAAGGGAGATTCCATTGAACAGCTTGGTTCGGCTCTGGAAGAGTACAAAAGAAAGTTTGCTGTCATCCGCCATCAACAAGGACTACTTTACAAGGAGCATCAAAGGTATGCCGAGCCGTAAAGATTGTTTATATTATAAGACGTGTTATATATATCAATTTTACATATGTTCAGTAATCAATAAAGCATGATTTTCAATCACCTCTTGTGCTTCGCTTCAGCGAAAGAGAGTCTTGGCAGAAAGAGCGGGACTCTTTTGCAGAGCTGAAATCCAAACTTGAGGAACAAAGGGAGGTGGACGCAGTAAAAATCAAAGAGTACAACGTAAGTCTCTTAAAGGGATAGTTACAAATGCAAATGATGTCACTGTGTTTTCATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38045
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 951 2439 24 52
Genomic Location (Zv9):
Chromosome 25 (position 18449663)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17865973
GRCz11 25 17962373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCCTAGACGTCAGTGTTCCTGCTTCCGAGCTGGAGAGAGCCAACAAA[C/T]AATACACTGAGCTCACCATCAAATACAGAAACCTCCTCCAAAAGGACAAC
Long Flanking Sequence:
ACGAGAAGTGTTTGACACGCCGTTACACCACTCTGCTGGAGCTGGAGCAGCACTTGAGGAAGGAGAATGCAAAACTAAAGGAGGATTTCACTCAAATGCAAGCCGCAGTTACAGAACGCATTGGCTACTTGCAGAGGTTCAAGGTATTTGCCTGCTCAGTACATCACTTCAACAGATAGAAAAGAACTTGGTGAATGATTTATTATTAGTAGATGCACCAATATAGGTTTTCAGTCGACAGTACTGATTTTGAACAAGGTTGCAAAAATTTTTTTAAAAGTCAGGGCTTGTTTAGGCCAATTAACTGGCCTGTTCAGTACATAAGCTTGGTCTTTCTTTATGAGCTATGGCTGTCATCTTTGTTACAGGTCTGTCACTGACCTGTACTGACCTCTATAAACCTGTTTTCCCCTCAGGAAATGGCTGCTTTTAAAATGGCCTCTTTGCAGAAATCCCTAGACGTCAGTGTTCCTGCTTCCGAGCTGGAGAGAGCCAACAAA[C/T]AATACACTGAGCTCACCATCAAATACAGAAACCTCCTCCAAAAGGACAACCACCTCGTTCAGAAGACCACCAGTCTGGAGCACCTGGAGGTACAGTACATCTTATGCACATCACACTCCACTAGTGTCGGCACCTTTGGTAGATATTTTATTTTTTTCAAATGTATTTATTTTTGTGGTAATTTTGTGTTGATATGTAATTATATTTGGTTCATGGTGCCTTCGTATTGTAAAAAGGTGTTTAGGTCCTTTGATAAAAAAAACAATAAAGAACAACAAACATATTTAACTGTCAGCATGACAAAGCTCTGGTTTTCCATAGGCTTACTGTTGTGTGCACCAAACTCTATATTGGTTTTACCTGACCATATAACCAGTGACCGTTTGCACAAACATTGGCATTTTGTTAAAAGTTAGTTTTATATTCTAGTTTGGCCATGTAGCTGTTATTTAAAACCAAATTCAATAGTTAAGAGCAGTCTTTATGGAAAGAAAAACACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30234
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1176 2439 29 52
Genomic Location (Zv9):
Chromosome 25 (position 18443540)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17859850
GRCz11 25 17956250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTGATTGAAAATTCTTTGTTAATAATTGCACTTCTCCTCTACAGGCT[G/T]AGTCTGATGAAAAGGCCCTGATCGCCAAACTCCATCAGCACATTGTGGCT
Long Flanking Sequence:
TTCTTGGATTAATACTAACGGCTTTAGTTGTAAGACATTATACACGGATGGTAATGATTTTAGAAGTGACATACGAGAGTATAAACTATATAGAAACATCAACATTATGTTATGTTTATTGATATTAATAAGCCCTGCTGCACTTCTCCAGACATGCCCACACTTCCCTGGAATACAGATTAAAAATGTAAGGGGAAAAAAATCAAACAATATCAAATTAGCCACTTTATAAAAAAAAAAAAGCTGAATTTTAATTGGAGCAAAAAAAATCAAATAAAAGCCCAATTCATTTTCAGAGTACTTAATAAAATTCAAACTTAAAATAAAAGTGTATTAAATGTTCAACGTTGCATTTTCTTCGGTTCATTTTTTTTTTATTAAAAAAAGGAAAGTAAATCTTGATTTTCATCTGCTTTTGAGAATCATTATTAGAATCATGAAATAAAAAAACAATTGATTGAAAATTCTTTGTTAATAATTGCACTTCTCCTCTACAGGCT[G/T]AGTCTGATGAAAAGGCCCTGATCGCCAAACTCCATCAGCACATTGTGGCTCTCCAGCTGAGCGAGACCACAGCAATTAGCCGTCTGGAGGCCACAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAACAAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCGAGGCAGGAGGGTCACCAGCGGGCCAGACACCTCCGGCACACCATCCAGGCCCTCCGCAGACAGTTCTCAGGAGCCCTGCCGCTGGCCCAGCAGGAGAAGTTTTCAAACACCATGCTCCACCTTCAAGAGGACAGGGCTCGGGTCAGAGAGGATGCACAGATAACGGAGGAAGAAAGAAGGAAGGCAGAAGGGAAGGCGCAGGAACTGGAGCTAAAGCTGAAAGGCTTGGAGGAGCTCATAGCAACACTCAAAGATGCTAAAGGGGCTCAAAAAGTAGGTTGATTGATTACAGACAAAGCTGTGATGTGAAAAAATACCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13473
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1223 2439 29 52
ENSDART00000090921 Nonsense 1223 2439 29 52
Genomic Location (Zv9):
Chromosome 25 (position 18443399)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17859709
GRCz11 25 17956109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCRCAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAA[C/T]AAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCRAGGCAGGAGGGT
Long Flanking Sequence:
ACTTCTCCAGACATGCCCACACTTCCCTGGAATACAGATTAAAAATGTAAGGGGAAAAAAATCAAACAATATCAAATTAGCCACTTTATAAAAAAAAAAAAGCTGAATTTTAATTGGAGCAAAAAAAATCAAATAAAAGCCCAATTCATTTTCAGAGTACTTAATAAAATTCAAACTTAAAATAAAAGTGTATTAAATGTTCAACGTTGCATTTTCTTCGGTTCATTTTTTTTTTATTAAAAAAAGGAAAGTAAATCTTGATTTTCATCTGCTTTTGAGAATCATTATTAGAATCATGAAATAAAAAAACAATTGATTGAAAATTCTTTGTTAATAATTGCACTTCTCCTCTACAGGCTGAGTCTGATGAAAAGGCCCTGATCGCCAAACTCCATCAGCACATTGTGGCTCTCCAGCTGAGCGAGACCACAGCAATTAGCCGTCTGGAGGCCACAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAA[C/T]AAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCGAGGCAGGAGGGTCACCAGCGGGCCAGACACCTCCGGCACACCATCCAGGCCCTCCGCAGACAGTTCTCAGGAGCCCTGCCGCTGGCCCAGCAGGAGAAGTTTTCAAACACCATGCTCCACCTTCAAGAGGACAGGGCTCGGGTCAGAGAGGATGCACAGATAACGGAGGAAGAAAGAAGGAAGGCAGAAGGGAAGGCGCAGGAACTGGAGCTAAAGCTGAAAGGCTTGGAGGAGCTCATAGCAACACTCAAAGATGCTAAAGGGGCTCAAAAAGTAGGTTGATTGATTACAGACAAAGCTGTGATGTGAAAAAATACCTAGCTACATTTTCAAGAATAAGTTGTGTATGCAATTTCTAAAAAATAATGCACATTTATTGTGATGATAGAGTGTAGATGGATAAATGAATTATAAACAGTTTAAGAGTGGATGGATGGATGGATGGATGGATGGATGGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11985
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1223 2439 29 52
ENSDART00000090921 Nonsense 1223 2439 29 52
Genomic Location (Zv9):
Chromosome 25 (position 18443399)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17859709
GRCz11 25 17956109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCRCAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAA[C/A]AAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCRAGGCAGGAGGGT
Long Flanking Sequence:
ACTTCTCCAGACATGCCCACACTTCCCTGGAATACAGATTAAAAATGTAAGGGGAAAAAAATCAAACAATATCAAATTAGCCACTTTATAAAAAAAAAAAAGCTGAATTTTAATTGGAGCAAAAAAAATCAAATAAAAGCCCAATTCATTTTCAGAGTACTTAATAAAATTCAAACTTAAAATAAAAGTGTATTAAATGTTCAACGTTGCATTTTCTTCGGTTCATTTTTTTTTTATTAAAAAAAGGAAAGTAAATCTTGATTTTCATCTGCTTTTGAGAATCATTATTAGAATCATGAAATAAAAAAACAATTGATTGAAAATTCTTTGTTAATAATTGCACTTCTCCTCTACAGGCTGAGTCTGATGAAAAGGCCCTGATCGCCAAACTCCATCAGCACATTGTGGCTCTCCAGCTGAGCGAGACCACAGCAATTAGCCGTCTGGAGGCCACAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAA[C/A]AAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCGAGGCAGGAGGGTCACCAGCGGGCCAGACACCTCCGGCACACCATCCAGGCCCTCCGCAGACAGTTCTCAGGAGCCCTGCCGCTGGCCCAGCAGGAGAAGTTTTCAAACACCATGCTCCACCTTCAAGAGGACAGGGCTCGGGTCAGAGAGGATGCACAGATAACGGAGGAAGAAAGAAGGAAGGCAGAAGGGAAGGCGCAGGAACTGGAGCTAAAGCTGAAAGGCTTGGAGGAGCTCATAGCAACACTCAAAGATGCTAAAGGGGCTCAAAAAGTAGGTTGATTGATTACAGACAAAGCTGTGATGTGAAAAAATACCTAGCTACATTTTCAAGAATAAGTTGTGTATGCAATTTCTAAAAAATAATGCACATTTATTGTGATGATAGAGTGTAGATGGATAAATGAATTATAAACAGTTTAAGAGTGGATGGATGGATGGATGGATGGATGGATGGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39478
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Essential Splice Site 1463 2439 33 52
Genomic Location (Zv9):
Chromosome 25 (position 18441417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17857727
GRCz11 25 17954127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTTCTCCTTTAAGGGTGTCTCAAAAGCATTTTCTTTTTCTCTGAGCA[G/T]AAGCTAAAAGAAAAGGAAGCTGCTTTATGGTCATCAGAACAGAATGTTTT
Long Flanking Sequence:
CTCTGCCGGATCCAAACCAGCCTTTAGCAAACCAATTAGACTATGCACTCGGAAAAATCAAAGAGCATGTTCGTACCATTCTTGAGACAAAAACTACCTGCAAAATTCTGGAAGAGGTACTTTTTAATCCAAGTTTAAAATCAATTCACCTTTACTTTACCAAAAGGCCTAAATATGAAAGTTCATGTAAAAATAATCGAATTCCTTCATGTGATGGGGGCTGTCATGTTAATCTGTGCTGAAGTGGAGCTACTGGCTTTATAGCACATAAATTCATCCACTTCTGTTGAGGTTGGGGAGGAATGTATTATAATAATACAATTTATGTGAAAAATAATTTTTGAAATGATAAGCATGAGTAAACATTCTAGTACGCCTCTAAAACAAAATCAGATCTTAGCACAGCAGGACCATTTTAATGCTCTTCTAAGAAAAATGTAAGATTTGGATAAACTTCTCCTTTAAGGGTGTCTCAAAAGCATTTTCTTTTTCTCTGAGCA[G/T]AAGCTAAAAGAAAAGGAAGCTGCTTTATGGTCATCAGAACAGAATGTTTTATCTCGAGACAAAGTAATCAATGAACTTAGACTTCGTCTACCAGCTGCTGCTGAGAGGGAGAAACTCCTGGCTGACCTGAGCAAACAGGAGGACTCTGAGAGCCAGCCCACCCTGAAAGTCGCTCACCAGACCATTAATAACCTCCAAGGGCGTCTGGATCAGAAAGAAGAGGTTCTCAAAAAGTACCAGAACCTTCTAGGAAAGGCTCGCCAGGTACCAGTTTAACATGTTGTAAAAATTGATAACTGTGTTTTTATTGCACAATTAAAATAAAATATCCCATCTTATTTTTCCAGGAGCAGGAAGAGATTGCCAAAAGACATGAGGAAGAGGTCCGGGCCCTTCATCAGAAACTAGACGTCTATATGGACACATCTCTGGACCGCTTCAAACAAACCGCTCTGGTACCTTGAGTATTAATTATAAAGCTCTAATTGGGCCAGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1383
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1844 2439 38 52
Genomic Location (Zv9):
Chromosome 25 (position 18437783)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17854093
GRCz11 25 17950493
KASP Assay ID:
554-1295.1 (used for ordering genotyping assays)
KASP Sequence:
AACACTTGAATGAGCTGAAGAAGAAGATTCAGAGGCTCAGCAGTGGCCTA[C/T]AGGTCAAATGCATTTTTCTTTTTTTTTTTGCAGTCCCTNGTACTGTGAATG
Long Flanking Sequence:
AATTCATAACATTAAAATATGATGAAAAGTGCTCATTTTAAATGGCTCTTTTAAATTTATTTGTTTTATTTTTTAAATCGGCCAGTTACCTTTAATAATTGTTTGTGAAGCGTTGAAGAGTATATTTTGGTCATCGTTTGTCAATCATAAAATACCTTTAAATGTAACTGATTGGAACAACGAATGAACTTTCAACATTTTATGACCCTTAAAATTTTAAGAGGACTGAATTTTATCCGAGCCCTAACAAAGCAAATAATGTTCCCCATGTTCCCCATCAGGCTTGTGTGAGAGACCTTAATGAGGAGCTCCAGCTGGCTAAGGATGGAGTACGAGCGGCAAAAGCCAGAGAAAACTCCCTTAAAGAGGACCTGGAGACCTTGAACAAGGATCTTCAGAGGAGCCAAAAATCACAGAATAAGCTGCAGAGTGAAAAGGAGGCTTTGGAGGAACACTTGAATGAGCTGAAGAAGAAGATTCAGAGGCTCAGCAGTGGCCTA[C/T]AGGTCAAATGCATTTTTCTTTTTTTTTTTGCAGTCCCTGTACTGTGAATGGTTAAGGTCATGAAAATCTTGTCTTGCTCTTCTTGAGTTATTCAAAAGCACTTGGACAGTGAGTCAGCGTCCTTTTCTTTTTCCTCGAAAAATGAAGAGCTTCTGCTCACTGTCTGGATGAACAGAGCCCTTCTTTGATAGCAGTGAATACGTCTAGACACTATTGTGCACCTCCTCGCTCTTATCAAAGGTTGCAGCCTTTGGGAAGAAATAAACAGAGCCATTAGAAGCTATAGTCATAGTCCTATCTGCTTCTTTTACATTTAAAGTGATTCAATTAACTTTATTTAGCACCGTTCAACTTTCAAAACCTGTTTACAAAAAGTGCTTTAATAAAGACACACTGCAGATCAGAATATTTGCAGATATAACCAATATGAGCATATTTTTTGTTTGTGTGCGCAGGCTCAGGTTGAGAGCGATGGACCCACTGTAGATGCTCTTCAGAAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461