Busch Lab

ZMP

dennd4a

Ensembl ID:
ENSDARG00000062721
ZFIN ID:
ZDB-GENE-060503-285
Description:
C-myc promoter-binding protein [Source:RefSeq peptide;Acc:NP_001074458]
Human Orthologue:
DENND4A
Human Description:
DENN/MADD domain containing 4A [Source:HGNC Symbol;Acc:24321]
Mouse Orthologue:
Dennd4a
Mouse Description:
DENN/MADD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2142979]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa43085 Nonsense Mutation detected in F1 DNA Not yet available
sa43084 Nonsense Mutation detected in F1 DNA Not yet available
sa12574 Nonsense Available for shipment Available now
sa43083 Nonsense Mutation detected in F1 DNA Not yet available
sa36626 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43085
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 513 1714 10 29
ENSDART00000090962 Nonsense 513 1674 10 28
ENSDART00000129591 Nonsense 513 1724 10 30
Genomic Location (Zv9):
Chromosome 18 (position 18866289)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19096512
GRCz11 18 19085578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAGCGCAGATCCCTGACCTGGAAGATCCTGCCAAGAAAAGCCTGT[A/T]AACATCTGATCAACACCCTCAGCAATCTCCACCAGCAACTGGATGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43084
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 811 1714 16 29
ENSDART00000090962 Nonsense 811 1674 16 28
ENSDART00000129591 Nonsense 820 1724 17 30
Genomic Location (Zv9):
Chromosome 18 (position 18852569)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19082792
GRCz11 18 19071858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTGATTTTGTGTTTAACGGTTTGTTTCTGGCCCTCTGGAGGTGTG[T/A]TATCGAGTGCTGATGCAGCTGTGTGGGCAATACGGTCAACCTGTTCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12574
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 885 1714 17 29
ENSDART00000090962 Nonsense 885 1674 17 28
ENSDART00000129591 Nonsense 894 1724 18 30
Genomic Location (Zv9):
Chromosome 18 (position 18849414)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19079637
GRCz11 18 19068703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTGTGGGGAAAGCTGAGAAATGTKGTCCGGGGTGTGGTGCTGTTCAAA[C/T]AAGTATGGAGGAGGCAGACCACCCACCCSAAAKACACTCATCTTTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43083
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 890 1714 17 29
ENSDART00000090962 Nonsense 890 1674 17 28
ENSDART00000129591 Nonsense 899 1724 18 30
Genomic Location (Zv9):
Chromosome 18 (position 18849399)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19079622
GRCz11 18 19068688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGAAATGTGGTCCGGGGTGTGGTGCTGTTCAAACAAGTATGGAGGAGG[C/T]AGACCACCCACCCGAAAGACACTCATCTTTCTGGTAAAACCCCCAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36626
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 963 1714 19 29
ENSDART00000090962 Nonsense 922 1674 18 28
ENSDART00000129591 Nonsense 972 1724 20 30
Genomic Location (Zv9):
Chromosome 18 (position 18841887)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19072110
GRCz11 18 19061176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGGGCTACGACTCTCTGTCTAAAGAGGAGGTGAGGTTTGGTGGAGGT[G/T]AAGAGCAGAACTCCTCTCCAGACATCAAGGAGAAGAAGGACAGAGACTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4020
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Essential Splice Site 1446 1714 23 29
ENSDART00000090962 Essential Splice Site 1405 1674 22 28
ENSDART00000129591 Essential Splice Site 1455 1724 24 30
Genomic Location (Zv9):
Chromosome 18 (position 18833076)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19063299
GRCz11 18 19052365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTGCCTCTGCTCAATGTGGACATCACAAACATGGGTGAACAAGAAAG[G/A]TAATTCAGTCTTAAATCAAAAYAATTCATATTTCTTTAGAGATATGGAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7854
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 1479 1714 24 29
ENSDART00000090962 Nonsense 1438 1674 23 28
ENSDART00000129591 Nonsense 1488 1724 25 30
Genomic Location (Zv9):
Chromosome 18 (position 18832895)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19063118
GRCz11 18 19052184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCAYCAAAAGTGTATGATGCCTCTAGCACTCTGTCCAACAAGGACAAA[A/T]AAGACCCTGTAAGGATGGTTTTCTCAGTTTTAAACTTCATGACCTTTCAG
Associated Phenotype:
Not determined