Busch Lab

ZMP

si:dkey-18f22.3

Ensembl ID:
ENSDARG00000062720
ZFIN ID:
ZDB-GENE-091116-32
Human Orthologue:
PCDH1
Human Description:
protocadherin 1 [Source:HGNC Symbol;Acc:8655]
Mouse Orthologue:
Pcdh1
Mouse Description:
protocadherin 1 Gene [Source:MGI Symbol;Acc:MGI:104692]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15672 Nonsense Available for shipment Available now
sa38793 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15672
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091004 Nonsense 214 1190 1 4
ENSDART00000139733 Nonsense 214 1190 2 5

The following transcripts of ENSDARG00000062720 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21127382)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21088796
GRCz11 10 21046177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTGGGAAGCCTTGATCGAGAGCTGAAAGACTCATACGACCTCACCATC[A/T]AAGCTGTGGATGGAGGAAATCCACCTCGCTATAGCAGTGCCTTGCTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38793
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091004 Nonsense 928 1190 2 4
ENSDART00000139733 Nonsense 928 1190 3 5

The following transcripts of ENSDARG00000062720 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21124663)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21086077
GRCz11 10 21043458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTGCCTCTGACATATCCGCCTGGAAGCCCTGACCTGGGCAGGCACTA[T/A]CGTTCCAATTCCCCATTGCCCTCCATCCAGCTCCAGGCCCAGTCCCCATC
Associated Phenotype:
Not determined