Busch Lab

ZMP

si:dkey-189g17.3

Ensembl ID:
ENSDARG00000062696
ZFIN ID:
ZDB-GENE-081105-39
Description:
Novel protein similar to vertebrate diacylglycerol kinase, beta 90kDa (DGKB) [Source:UniProtKB/TrEMB
Human Orthologue:
DGKG
Human Description:
diacylglycerol kinase, gamma 90kDa [Source:HGNC Symbol;Acc:2853]
Mouse Orthologue:
Dgkg
Mouse Description:
diacylglycerol kinase, gamma Gene [Source:MGI Symbol;Acc:MGI:105060]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa17269 Nonsense Available for shipment Available now
sa788 Nonsense Available for shipment Available now
sa16216 Nonsense Available for shipment Available now
sa34624 Nonsense Mutation detected in F1 DNA Not yet available
sa41406 Nonsense Mutation detected in F1 DNA Not yet available
sa34625 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16348 Essential Splice Site Available for shipment Available now
sa8586 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27387
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 233 865 5 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Essential Splice Site 50 682 1 20
Genomic Location (Zv9):
Chromosome 9 (position 23518836)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22674622
GRCz11 9 22485491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTACTTGTCCCTGCTAGAGCGAGGGACGCCAGAGGACAAGCTTGAGTG[T/G]AAGTTTGATTGTAAATTAGTCAAATACATAATCTTTGTTAGAAATTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17269
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 238 865 6 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Nonsense 55 682 2 20
Genomic Location (Zv9):
Chromosome 9 (position 23520613)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22676399
GRCz11 9 22487268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTGTCTTAWCTTTTGTTTCTTTCACCCTGAAGTCATGTTCAGGCTGTA[C/A]GACACAGATGGCAACGGTCTGCTGGACAGTTCGGTAAGTCCTAYATCACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27388
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 314 865 8 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Essential Splice Site 131 682 4 20
Genomic Location (Zv9):
Chromosome 9 (position 23522508)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22678294
GRCz11 9 22489163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAATGACCACCATACCACTCCTGGTACTGCTGGGAATGGAGACGG[T/A]AAGAAAACAATAAGTTGACACTTCGGTTTAAGGTGTCTGTGTTACAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 348 865 9 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Nonsense 165 682 5 20
Genomic Location (Zv9):
Chromosome 9 (position 23524405)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22680191
GRCz11 9 22491060
KASP Assay ID:
554-0693.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCAGCCTACTGTAATTACTGCCACACCATGTTGTTAGGAGTACGAAAG[C/T]AGGGTCTTTGCTGCGCACGTGAGTATCTGTGTGTCTGTTTTTCTATAGTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16216
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 407 865 11 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Nonsense 224 682 7 20
Genomic Location (Zv9):
Chromosome 9 (position 23527046)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22682832
GRCz11 9 22493701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGGCAACTCCTCAGCAAAATGTGACAAATGTCACCGCAGTATCAAGTG[C/A]TATCAAGGTCTGACAGGCCTTCACTGTGTTTGGTGTCAAATCACTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34624
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 488 865 13 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Nonsense 305 682 9 20
Genomic Location (Zv9):
Chromosome 9 (position 23530618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22686404
GRCz11 9 22497273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACCAGTCCTGAGGACACCGGCCAGTGTTTCAAGTTCACCGGTGATGGA[C/T]AGGCGCTGCAAGTGAGCCCCTAGAAGACTAAAAATATCTGTATAACAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41406
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 608 865 18 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Nonsense 425 682 14 20
Genomic Location (Zv9):
Chromosome 9 (position 23556106)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22711892
GRCz11 9 22522761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCATGTCTGTGTTGTGATTGACAGGTTATGAAGGAGGAAGTCTGGTC[A/T]AGTTCCTCAGGGATATCGAGCACAGCACTGAGGTTCTTCTTGACCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 675 865 19 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Essential Splice Site 492 682 15 20
Genomic Location (Zv9):
Chromosome 9 (position 23581638)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22737424
GRCz11 9 22548293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCGCTTCCATCTGATGAGAGAAAAACATCCTGAGAAGTTCAACAGCAG[G/A]TAAGAGAAGATGCATATTTATAAATCAACATATGCAGAAAAGGCAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16348
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 675 865 19 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Essential Splice Site 492 682 15 20
Genomic Location (Zv9):
Chromosome 9 (position 23581639)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22737425
GRCz11 9 22548294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCGCTTCCATCTGATGAGAGAAAAACATCCWGAGAAGTTCAACAGCAGG[T/G]AAGRGAAGAKGCATATTTATAAATCAACATATGSAGAAAAGGCAAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8586
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 705 865 20 24
ENSDART00000131214 None None 84 None 3
ENSDART00000146028 Essential Splice Site 522 682 16 20
Genomic Location (Zv9):
Chromosome 9 (position 23611688)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22767474
GRCz11 9 22578343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCATTTCAGCCACTTGTAAAAAGCTGAACGAAACTATTGAAGTGGAGG[T/G]GAGTTCGGGACATTCAGCCTATCAAKAGTGGCCTGTTTTAGCTTACAGCG
Associated Phenotype:
Not determined