Busch Lab

ZMP

si:ch211-155k24.6

Ensembl ID:
ENSDARG00000062688
ZFIN ID:
ZDB-GENE-060503-106
Human Orthologue:
GPNMB
Human Description:
glycoprotein (transmembrane) nmb [Source:HGNC Symbol;Acc:4462]
Mouse Orthologue:
Gpnmb
Mouse Description:
glycoprotein (transmembrane) nmb Gene [Source:MGI Symbol;Acc:MGI:1934765]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11355 Essential Splice Site Available for shipment Available now
sa30711 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13099 Nonsense Available for shipment Available now
sa13185 Nonsense Available for shipment Available now
sa23503 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa11355
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Essential Splice Site 116 621 None 12
ENSDART00000144891 Essential Splice Site 55 499 None 11
Genomic Location (Zv9):
Chromosome 19 (position 20750424)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20683804
GRCz11 19 20268127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGAGGACAGCAATGGCAACCTGGTGTATGATGAACACTGTGATGACGG[T/C]ACGATGGACACCTCAGGTGCTTCATACCACTGTAATCTCTAAACAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30711
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Essential Splice Site 228 621 6 12
ENSDART00000144891 Essential Splice Site 167 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744415)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677795
GRCz11 19 20262118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAAACCATTTACATTATTAGATTTTTATTCCATGTGTTTCTTTCATCT[A/G]GATAAGATTCCACTCTCCGTCAACATTTCCCAGAAGGAAGCAGCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13099
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Nonsense 261 621 6 12
ENSDART00000144891 Nonsense 200 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744315)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677695
GRCz11 19 20262018
KASP Assay ID:
2261-3216.1 (used for ordering genotyping assays)
KASP Sequence:
GAGCGGACAGRAACATCTTTGTCAGAGGGTCTGATGTTATTTTCAACGTC[C/T]AGCTCCACGACCCCAGTAACTATCTGAAAACWGCTGATGCGGTGGACTWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13185
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Nonsense 279 621 6 12
ENSDART00000144891 Nonsense 218 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744260)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677640
GRCz11 19 20261963
KASP Assay ID:
2261-3215.1 (used for ordering genotyping assays)
KASP Sequence:
CCACGACCCCAGTAACTATCTGAAAACWGCTGATGCGGTGGACTWCATTT[G/A]GGACTTTCGGGAYGGCAACCAGYTGGTGACACACAGCAGCGTGGCAACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4804
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Essential Splice Site 334 621 6 12
ENSDART00000144891 Essential Splice Site 273 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677472
GRCz11 19 20261795
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTCCACCGACTCCAACACCAGTGCACTTTACACAAGCTCACACCACAG[G/T]TAATCTCATAAACACAGGCACTTTAYGCTCCCAGACAGGAGAGATGCTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29191
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Nonsense 409 621 8 12
ENSDART00000144891 Nonsense 348 499 8 11
Genomic Location (Zv9):
Chromosome 19 (position 20741709)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20675089
GRCz11 19 20259412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGCTCCAGCTACAACCAGCCCACTGCACCGCCGCTGCTCAAACAC[A/T]AACACTTCCAGGAGTCAGACTGTTTCCGCCACATGTACGGCTCCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23503
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Missense 603 621 12 12
ENSDART00000144891 Essential Splice Site 481 499 11 11
Genomic Location (Zv9):
Chromosome 19 (position 20734216)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20667596
GRCz11 19 20251919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGGATGCAGAGAGGAATACTGATAGCTGGGGCTTAGGCAAACTTAGA[G/T]CAGTTCTGTTCTCAGTGGATGAGGAAAGAAGCTGTTTATTGACCGAAAAG
Associated Phenotype:
Not determined