Busch Lab

ZMP

KCNH7 (2 of 2)

Ensembl ID:
ENSDARG00000062687
Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Human Orthologue:
KCNH7
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Mouse Orthologue:
Kcnh7
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15943 Nonsense Available for shipment Available now
sa7578 Missense Mutation detected in F1 DNA Not yet available
sa6067 Nonsense Mutation detected in F1 DNA Not yet available
sa31499 Nonsense Available for shipment Available now
sa38540 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15943
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Nonsense 152 1208 3 24
Genomic Location (Zv9):
Chromosome 6 (position 10401346)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10254972
GRCz11 6 10490399
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGCAGCATGGATTCATTAGACCGACTCAAYCACACCTCCCCAGCCAGA[C/T]AAGAACAAAGTGAGGATATTTCTTTTTATGATTCCCTCTCTTTAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7578
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Missense 334 1208 6 24
Genomic Location (Zv9):
Chromosome 6 (position 10433304)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10286930
GRCz11 6 10522357
KASP Assay ID:
554-4250.1 (used for ordering genotyping assays)
KASP Sequence:
ATTTAATCAGATCAAGTCCAGCCTCYTGGGCTCCACGTCTGACTCAAACC[T/C]GACCAAGTACAGCACCATCAACAAGATCCCACTCATCACTCTCAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6067
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Nonsense 581 1208 8 24
Genomic Location (Zv9):
Chromosome 6 (position 10451178)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10304804
GRCz11 6 10540231
KASP Assay ID:
554-3957.1 (used for ordering genotyping assays)
KASP Sequence:
CTCCTCATGTGTATCTTTGCACTGATTGCCCATTGGTTGGCTTGCATATG[G/A]TATGCGATCGGCAATGTGGAGAGGCTCTATCTGGACCACACCATTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31499
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Nonsense 798 1208 10 24
Genomic Location (Zv9):
Chromosome 6 (position 10458495)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10312121
GRCz11 6 10547548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTCTGGTGCATGGTGGGGATGTTCTCACTGCCCTCTACTTTCTCGCC[A/T]GAGGGTCTATCGAGATCCTCAGAGATGACATTGTGGTGGCCATCTTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38540
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Nonsense 805 1208 10 24
Genomic Location (Zv9):
Chromosome 6 (position 10458516)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10312142
GRCz11 6 10547569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTCTCACTGCCCTCTACTTTCTCGCCAGAGGGTCTATCGAGATCCTC[A/T]GAGATGACATTGTGGTGGCCATCTTGGGTGAGCATTAAACAATTAATAAA
Associated Phenotype:
Not determined