Busch Lab

ZMP

si:dkey-90a13.7

Ensembl ID:
ENSDARG00000062662
ZFIN ID:
ZDB-GENE-090313-353
Human Orthologue:
LMOD3
Human Description:
leiomodin 3 (fetal) [Source:HGNC Symbol;Acc:6649]
Mouse Orthologue:
Lmod3
Mouse Description:
leiomodin 3 (fetal) Gene [Source:MGI Symbol;Acc:MGI:2444169]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6731 Nonsense Mutation detected in F1 DNA Not yet available
sa6732 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13018 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6731
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090864 Nonsense 127 670 2 4
Genomic Location (Zv9):
Chromosome 23 (position 13930698)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14062631
GRCz11 23 13818708
KASP Assay ID:
554-5032.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGACAAACCACCCACTGGATCATTTGATCACAGATYGCTGGTGGAATA[T/A]CTSTACTGGGAGAAAGAGTCCAAACGCATGCTGGAGGAAGAGAGGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6732
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090864 Essential Splice Site 151 670 2 4
Genomic Location (Zv9):
Chromosome 23 (position 13930771)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14062704
GRCz11 23 13818781
KASP Assay ID:
554-5033.1 (used for ordering genotyping assays)
KASP Sequence:
AACGCATGCTGGAGGAAGAGAGGGTTCCCACAACTCTATTACCCAGTCAG[G/A]TAAGGCTAGTTATTGTCTGCATTCYTTACAGTTTATAACTTTACTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13018
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090864 Nonsense 338 670 3 4
Genomic Location (Zv9):
Chromosome 23 (position 13931579)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14063512
GRCz11 23 13819589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCCCTCTGTCACAGAYGTCAATCTRAACAAYATTGAAAACATTCCAAAA[G/T]AAATGCTCCTTGATTACGTCAACTCSCTGAAGAAGAACCGACATGTTAAG
Associated Phenotype:
Not determined