Busch Lab

ZMP

ydjc

Ensembl ID:
ENSDARG00000062655
ZFIN ID:
ZDB-GENE-060526-182
Description:
UPF0249 protein ydjC homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BIR6]
Human Orthologue:
YDJC
Human Description:
YdjC homolog (bacterial) [Source:HGNC Symbol;Acc:27158]
Mouse Orthologue:
Ydjc
Mouse Description:
YdjC homolog (bacterial) Gene [Source:MGI Symbol;Acc:MGI:1916351]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3534
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090851 Nonsense 143 313 4 5
Genomic Location (Zv9):
Chromosome 5 (position 14535205)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12832642
GRCz11 5 13332859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGAGTCMTTGCTGAATATAATTTTTWAAAAATATTTTTTTCAGATGTG[C/T]GAGAGGTCTTTGCACAAGTTCTCTCTGATTTTGGGATCACCTACACCCGG
Associated Phenotype:
Not determined