Busch Lab

ZMP

rif1

Ensembl ID:
ENSDARG00000062650
ZFIN ID:
ZDB-GENE-030131-3406
Description:
telomere-associated protein RIF1 [Source:RefSeq peptide;Acc:NP_001074275]
Human Orthologue:
RIF1
Human Description:
RAP1 interacting factor homolog (yeast) [Source:HGNC Symbol;Acc:23207]
Mouse Orthologue:
Rif1
Mouse Description:
Rap1 interacting factor 1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1098622]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7629 Missense Mutation detected in F1 DNA Not yet available
sa6113 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10257 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7629
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Missense 241 2347 7 34
ENSDART00000110992 Missense 248 2392 7 35
ENSDART00000143972 Missense 248 2392 8 36
Genomic Location (Zv9):
Chromosome 9 (position 23820831)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22976617
GRCz11 9 22787486
KASP Assay ID:
554-4112.1 (used for ordering genotyping assays)
KASP Sequence:
AATCCTGTAGGTGCTCATCCCTGAAATGCAGAAGCTCTTTGCGTCTAAGA[A/T]CGAGACAAACATGTTGAAACTCTGGCCTTTGTTTGTAAGACTTCTGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6113
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Essential Splice Site 740 2347 19 34
ENSDART00000110992 Essential Splice Site 785 2392 20 35
ENSDART00000143972 Essential Splice Site 785 2392 21 36
Genomic Location (Zv9):
Chromosome 9 (position 23826448)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22982234
GRCz11 9 22793103
KASP Assay ID:
554-3902.1 (used for ordering genotyping assays)
KASP Sequence:
AGTATGGACTTTTCTCCATATACCCCTCAGTTCCAGCAGAAGATGAAATG[T/C]AAGGCTTTGGCTTCAGATTTCAGTTTTATAACACTATCTTGTGACTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27389
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Essential Splice Site 910 2347 22 34
ENSDART00000110992 Essential Splice Site 955 2392 23 35
ENSDART00000143972 Essential Splice Site 955 2392 24 36
Genomic Location (Zv9):
Chromosome 9 (position 23827218)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22983004
GRCz11 9 22793873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCCACTTTTGGAAATGCGCTCACCTTGAGTTACCCAGAACCTCTGAAG[T/C]AAGCTTTCATTTTATTGTTAAGCCACCTTTTCACTGCACACGATAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10257
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Nonsense 2111 2347 30 34
ENSDART00000110992 Nonsense 2156 2392 31 35
ENSDART00000143972 Nonsense 2156 2392 32 36
Genomic Location (Zv9):
Chromosome 9 (position 23833622)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22989408
GRCz11 9 22800277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATATCTTCTTTTGTTGCAGTATATCACTACACCAACAAAAGGYGGCTA[T/A]ACAAGTCTGAGTCCACGTAACCTCCGTAGCCCTGGATCCAAAAGCTCTAA
Associated Phenotype:
Not determined